Jatropha Genome Database

JcCB0019891.20
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0019891.20 + phase: 1 /pseudo/partial
         (211 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29852.m001993 conserved hypothetical protein                          105   1e-22
55843.m000006 Photosystem I P700 chlorophyll a apoprotein A2, pu...   105   1e-22
45070.m000007 conserved hypothetical protein                           78   2e-14

>29852.m001993 conserved hypothetical protein
          Length = 879

 Score =  105 bits (53), Expect = 1e-22
 Identities = 91/103 (88%), Gaps = 3/103 (2%)
 Strand = Plus / Plus

                                                                       
Query: 97  cttcaacgaatagtgcagccaccaatgtaggttgaagcatacggttgcccggctagttaa 156
           |||||||||||||| |||||  ||||| |||| |||||||| |||||||||||| |||||
Sbjct: 569 cttcaacgaatagtccagccttcaatgcaggtcgaagcatatggttgcccggctggttaa 628

                                                      
Query: 157 acg---ttaatgaaaatagtaattcactattcttaacaatagg 196
           | |   |||||||||||||||||||| ||||||||||||||||
Sbjct: 629 atgctattaatgaaaatagtaattcattattcttaacaatagg 671


>55843.m000006 Photosystem I P700 chlorophyll a apoprotein A2,
           putative
          Length = 943

 Score =  105 bits (53), Expect = 1e-22
 Identities = 91/103 (88%), Gaps = 3/103 (2%)
 Strand = Plus / Plus

                                                                       
Query: 97  cttcaacgaatagtgcagccaccaatgtaggttgaagcatacggttgcccggctagttaa 156
           |||||||||||||| |||||  ||||| |||| |||||||| |||||||||||| |||||
Sbjct: 569 cttcaacgaatagtccagccttcaatgcaggtcgaagcatatggttgcccggctggttaa 628

                                                      
Query: 157 acg---ttaatgaaaatagtaattcactattcttaacaatagg 196
           | |   |||||||||||||||||||| ||||||||||||||||
Sbjct: 629 atgctattaatgaaaatagtaattcattattcttaacaatagg 671


>45070.m000007 conserved hypothetical protein
          Length = 623

 Score = 77.8 bits (39), Expect = 2e-14
 Identities = 78/91 (85%)
 Strand = Plus / Plus

                                                                       
Query: 6   atgcttgctttcggtattccagagaaacaaatattgatcgaactcatatttgatcaatgg 65
           ||||||||||| |||| ||  ||||||||||| |||||||||| ||||||||  ||||||
Sbjct: 460 atgcttgcttttggtactctggagaaacaaatcttgatcgaacccatatttgcccaatgg 519

                                          
Query: 66  ttataatccgctttcggtaaaacttcatatg 96
            || |||| |||  |||||||||||||||||
Sbjct: 520 atacaatctgctcacggtaaaacttcatatg 550



 Score = 60.0 bits (30), Expect = 5e-09
 Identities = 48/54 (88%)
 Strand = Plus / Plus

                                                                 
Query: 97  cttcaacgaatagtgcagccaccaatgtaggttgaagcatacggttgcccggct 150
           |||||||||||||| |||||  ||||| |||| |||||||| ||||||||||||
Sbjct: 569 cttcaacgaatagtccagccttcaatgcaggtcgaagcatatggttgcccggct 622