Jatropha Genome Database

JcCB0018541.20
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0018541.20 + phase: 0 
         (390 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

28355.m000099 conserved hypothetical protein                           70   1e-11

>28355.m000099 conserved hypothetical protein
          Length = 411

 Score = 69.9 bits (35), Expect = 1e-11
 Identities = 86/103 (83%)
 Strand = Plus / Plus

                                                                       
Query: 66  tttagctatttgggatttgggcagtcctttatatgactcgtatgaattggtttctgttag 125
           ||||||| | |||||||| ||||| || ||||| ||||| |||||  |||| ||  ||||
Sbjct: 57  tttagctgtatgggatttaggcagcccattatacgactcatatgaggtggtatcacttag 116

                                                      
Query: 126 ctatcttattgaacgccatctaatgacattgccatctcttgga 168
           | |||||||||||||||| ||||||||  | ||||||||||||
Sbjct: 117 ccatcttattgaacgccacctaatgacccttccatctcttgga 159