Jatropha Genome Database

JcCB0018211.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0018211.10 + phase: 0 /partial
         (1122 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30024.m001701 conserved hypothetical protein                           70   3e-11

>30024.m001701 conserved hypothetical protein
          Length = 312

 Score = 69.9 bits (35), Expect = 3e-11
 Identities = 44/47 (93%)
 Strand = Plus / Plus

                                                          
Query: 258 agatgagtcgggctctgttattgggtttaacttgatttctcagtctg 304
           ||||||||| || |||| |||||||||||||||||||||||||||||
Sbjct: 255 agatgagtctggttctgctattgggtttaacttgatttctcagtctg 301