Jatropha Genome Database
- JcCB0016381.30
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCB0016381.30 + phase: 0
(285 letters)
Database: castor_wgs_0.1_cds
31,221 sequences; 31,347,911 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
29848.m004599 sucrose phosphate syntase, putative 232 9e-61
28543.m000384 sucrose phosphate syntase, putative 74 5e-13
>29848.m004599 sucrose phosphate syntase, putative
Length = 3075
Score = 232 bits (117), Expect = 9e-61
Identities = 234/273 (85%)
Strand = Plus / Plus
Query: 1 atggcgggaaatgactggataaacagttacctggatgcaatactcgacgttgatccggga 60
||||||||||| |||||||||||||||||||| || || || || ||||||||||| |||
Sbjct: 1 atggcgggaaacgactggataaacagttacctagaagcgatcctagacgttgatcctgga 60
Query: 61 attgacaatgcaaaattgtcgctgttgcttagggagagaggtcgtttcagtcccactcgc 120
|| ||| | ||||||| |||| |||| | ||||||||||| ||||| ||||| |||||
Sbjct: 61 atcgacgaggcaaaatcgtcgttgttattgagggagagaggccgttttagtcctactcgt 120
Query: 121 tacttcgtcgaagaggttattactggctttgacgagactgatctccatcgttcctggctt 180
||||| || ||||||||||||||||| ||||| |||||||| || || ||||| ||| ||
Sbjct: 121 tactttgttgaagaggttattactggttttgatgagactgaccttcaccgttcatggatt 180
Query: 181 cgagctgcagctatgagaagcacgcaagagaggaataccagattagagaacatgtgttgg 240
|||||||| |||||||| ||||| || ||||||||||| || || || || |||||||||
Sbjct: 181 cgagctgccgctatgaggagcacacaggagaggaatacaaggttggaaaatatgtgttgg 240
Query: 241 aggatttggaacttggctcggaagaagaaacag 273
||||||||||| |||||||| ||||||||||||
Sbjct: 241 aggatttggaatttggctcgcaagaagaaacag 273
>28543.m000384 sucrose phosphate syntase, putative
Length = 2997
Score = 73.8 bits (37), Expect = 5e-13
Identities = 49/53 (92%)
Strand = Plus / Plus
Query: 208 gagaggaataccagattagagaacatgtgttggaggatttggaacttggctcg 260
||||||||||| ||||| ||||| ||||||||||||||||||||||| |||||
Sbjct: 208 gagaggaatacaagattggagaatatgtgttggaggatttggaacttagctcg 260