Jatropha Genome Database

JcCB0012061.30
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0012061.30 - phase: 2 /partial
         (403 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30076.m004444 conserved hypothetical protein                           54   7e-07
30170.m014200 endoplasmin, putative                                    52   3e-06

>30076.m004444 conserved hypothetical protein
          Length = 5700

 Score = 54.0 bits (27), Expect = 7e-07
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                           
Query: 296  ttagatgttctgagattggcttttctagatg 326
            |||||||||||||| ||||||||||||||||
Sbjct: 3379 ttagatgttctgaggttggcttttctagatg 3409


>30170.m014200 endoplasmin, putative
          Length = 2451

 Score = 52.0 bits (26), Expect = 3e-06
 Identities = 65/78 (83%)
 Strand = Plus / Plus

                                                                        
Query: 74   aagaaaggcgaatatgcaaagttttggaatgagcttggcgagtccatcaaactcaacatt 133
            ||||||||  |||||||||| || ||||||||| ||||| |||| ||||||||    || 
Sbjct: 1525 aagaaaggtcaatatgcaaaattctggaatgagtttggcaagtctatcaaacttggtatc 1584

                              
Query: 134  atggaagatgcaactaac 151
            || |||||||||||||||
Sbjct: 1585 attgaagatgcaactaac 1602