Jatropha Genome Database

JcCB0011561.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0011561.10 + phase: 0 /short
         (129 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30131.m007172 conserved hypothetical protein                           74   2e-13

>30131.m007172 conserved hypothetical protein
          Length = 270

 Score = 73.8 bits (37), Expect = 2e-13
 Identities = 73/85 (85%)
 Strand = Plus / Plus

                                                                       
Query: 43  ccatcaaaaactacgcatagaggtggattttgcagaggatgttgtgctggtttatgttgc 102
           |||||| ||||||  || ||||||||||  |||||||||| |||||||||  | ||||||
Sbjct: 184 ccatcagaaactaaacaaagaggtggatgctgcagaggattttgtgctggaatgtgttgc 243

                                    
Query: 103 tgctgccttctggatgcttgctttt 127
           |||||||| || |||||||||||||
Sbjct: 244 tgctgcctcctagatgcttgctttt 268