Jatropha Genome Database
- JcCB0009671.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCB0009671.10 + phase: 0 /pseudo/partial
(348 letters)
Database: castor_wgs_0.1_cds
31,221 sequences; 31,347,911 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
29634.m002088 ring finger protein, putative 343 4e-94
>29634.m002088 ring finger protein, putative
Length = 951
Score = 343 bits (173), Expect = 4e-94
Identities = 284/321 (88%)
Strand = Plus / Plus
Query: 28 caggatgcatgggaggaggtcgatccagatgagctttcatatgaggagttgcttgcattg 87
|||||||||||||| ||||| ||||||||||| ||||| |||||||| ||| |||| |
Sbjct: 628 caggatgcatgggaagaggttgatccagatgaactttcttatgaggaattgattgcgcta 687
Query: 88 ggtgaagttgttggaactgagagtagggggctttcagctgatacaattgcctctctgcct 147
|||||||||||||||| |||||||| |||||||| |||||||||||||||||| | ||
Sbjct: 688 ggtgaagttgttggaagcgagagtagagggctttctgctgatacaattgcctctttacca 747
Query: 148 tcagtaaacttcaaggcaggaagcagtcagaacggaagcaatgattcctgcgtcatatgt 207
|||| |||| ||||| |||||||||||||| |||| ||||||||||| |||||||||
Sbjct: 748 acagtgaactataaggctggaagcagtcagaatggaactaatgattcctgtgtcatatgt 807
Query: 208 cgtttagattacgatgatggtgagaccctaacagtgctttcttgcaaacattcctaccat 267
|||||||||||||| |||||||||||||| ||| ||||||||||||||||||| ||||||
Sbjct: 808 cgtttagattacgaggatggtgagaccctgacactgctttcttgcaaacattcttaccat 867
Query: 268 tcagaatgcataaatgattggttgaaaataaacaaggtttgtcctgtctgcagcaaagag 327
||||| ||||||||| | ||||||||||||||||||||||||||||||||||||| |||
Sbjct: 868 tcagagtgcataaataactggttgaaaataaacaaggtttgtcctgtctgcagcaccgag 927
Query: 328 gtctccagttcttgacacagc 348
||||||| ||| ||||||||
Sbjct: 928 gtctccacttccggacacagc 948