Jatropha Genome Database

JcCB0008321.20
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0008321.20 + phase: 0 /partial
         (456 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30131.m006860 conserved hypothetical protein                          176   7e-44

>30131.m006860 conserved hypothetical protein
          Length = 966

 Score =  176 bits (89), Expect = 7e-44
 Identities = 107/113 (94%)
 Strand = Plus / Plus

                                                                       
Query: 344 accttccctccttccccgcacgtgtaattgaccaaaggagattgagtttcctctttcaaa 403
           |||| ||||| |||||||||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 341 acctcccctctttccccgcacgtgtaattgatcaaaggagattgagtttcctctttcaaa 400

                                                                
Query: 404 aggaacttaagaacagtgatgtaagctccctgaagaggatgatactcccaaag 456
           ||||||||||||||||||||||||||||||| ||||||||| | |||||||||
Sbjct: 401 aggaacttaagaacagtgatgtaagctccctaaagaggatggttctcccaaag 453