Jatropha Genome Database

JcCB0008321.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0008321.10 + phase: 0 /pseudo/partial
         (482 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30174.m008962 ubiquitin-protein ligase, putative                       74   8e-13

>30174.m008962 ubiquitin-protein ligase, putative
          Length = 1686

 Score = 73.8 bits (37), Expect = 8e-13
 Identities = 49/53 (92%)
 Strand = Plus / Plus

                                                                 
Query: 162  attggcatatcttgatggtccattgccccaagaatctgtagttaggacattga 214
            |||||||||||||||||||||| ||||||||||||||| |||| || ||||||
Sbjct: 1104 attggcatatcttgatggtccactgccccaagaatctgcagttggggcattga 1156