Jatropha Genome Database

JcCB0004801.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0004801.10 - phase: 0 
         (630 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30131.m006862 conserved hypothetical protein                           66   3e-10
29765.m000749 bromodomain-containing protein, putative                 54   1e-06

>30131.m006862 conserved hypothetical protein
          Length = 651

 Score = 65.9 bits (33), Expect = 3e-10
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                
Query: 502 gaggatgatcctctggctgaggttgatttggacaacattctaccctcgaggac 554
           |||||||||||| |||| |||||||||||||| |||||| |||| ||||||||
Sbjct: 508 gaggatgatcctttggccgaggttgatttggataacattttaccgtcgaggac 560


>29765.m000749 bromodomain-containing protein, putative
          Length = 1158

 Score = 54.0 bits (27), Expect = 1e-06
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 309 agaagaagaagacgaagacgatgctgattatgatgatga 347
           |||||||||||| ||||| ||||||||| ||||||||||
Sbjct: 309 agaagaagaagaagaagaagatgctgatgatgatgatga 271