Jatropha Genome Database

JcCB0003651.20
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCB0003651.20 + phase: 0 /pseudo
         (999 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

28455.m000362 WRKY transcription factor, putative                     236   2e-61
29883.m002008 WRKY transcription factor, putative                     109   3e-23
29644.m000187 hypothetical protein                                     76   5e-13
30076.m004648 conserved hypothetical protein                           72   7e-12
29598.m000445 WRKY transcription factor, putative                      62   7e-09

>28455.m000362 WRKY transcription factor, putative
          Length = 1104

 Score =  236 bits (119), Expect = 2e-61
 Identities = 241/281 (85%), Gaps = 3/281 (1%)
 Strand = Plus / Plus

                                                                       
Query: 532 gcctcaactggtggatgtcactgttcaaagcgaaggaaactgagaatcaagaaaatagtt 591
           ||||||||||| |||||||||||||||||| |||||||| ||||||||||||||||| ||
Sbjct: 634 gcctcaactggaggatgtcactgttcaaagagaaggaaaatgagaatcaagaaaataatt 693

                                                                       
Query: 592 caagtgccagct---ttaagtggcaagttagctgatataccaccagatgattatacttgg 648
           ||||| || |||   | |||||| || ||||| || ||||| ||||| ||||| ||||||
Sbjct: 694 caagttcctgctacttcaagtggtaaattagcagacatacctccagacgattacacttgg 753

                                                                       
Query: 649 agaaaatatggacagaaacccataaagggatctccttatcccaggagctattacaaatgt 708
           || |||||||||||||||||||| || |||||||||||||| ||||||||||||||||| 
Sbjct: 754 aggaaatatggacagaaacccattaaaggatctccttatcctaggagctattacaaatgc 813

                                                                       
Query: 709 agcagcatgaggggttgccctgcaagaaagcatgtggaaagatgtttacaggatcctagt 768
           || |||||||| || ||||||||||| |||||||| ||| ||||| | || |||||   |
Sbjct: 814 agtagcatgagaggctgccctgcaaggaagcatgtcgaacgatgtctgcaagatccggct 873

                                                    
Query: 769 atgttacttgtaacctatgaaggggaccatagtcactccaa 809
           |||||| | || ||||||||||| ||||||  |||||||||
Sbjct: 874 atgttagtcgtcacctatgaaggagaccattctcactccaa 914



 Score =  117 bits (59), Expect = 1e-25
 Identities = 112/129 (86%), Gaps = 3/129 (2%)
 Strand = Plus / Plus

                                                                       
Query: 110 gaagcattcaagaagtgagtctgattgctcaaggtgcaataaaagaattcaataatctac 169
           ||||||||||||||||||| ||||| |||||||||||| |||| |||||||  |||||||
Sbjct: 101 gaagcattcaagaagtgagcctgatagctcaaggtgcagtaaatgaattcagaaatctac 160

                                                                       
Query: 170 tcactcttcttgatgaatcaacaaagtc---taatcctaaaagaattaggaaaggtcctt 226
           | ||||||||||||| ||||||| | ||   | ||||||| ||||| | |||||||||||
Sbjct: 161 ttactcttcttgatggatcaacacaatctgatcatcctaagagaataaagaaaggtcctt 220

                    
Query: 227 tgccacttt 235
           |||||||||
Sbjct: 221 tgccacttt 229


>29883.m002008 WRKY transcription factor, putative
          Length = 1062

 Score =  109 bits (55), Expect = 3e-23
 Identities = 112/131 (85%)
 Strand = Plus / Plus

                                                                       
Query: 619 gctgatataccaccagatgattatacttggagaaaatatggacagaaacccataaaggga 678
           |||||||| || || ||||||||| | ||||| || ||||| |||||||| || ||||| 
Sbjct: 844 gctgatatccctcctgatgattattcatggaggaagtatgggcagaaaccgatcaagggt 903

                                                                       
Query: 679 tctccttatcccaggagctattacaaatgtagcagcatgaggggttgccctgcaagaaag 738
           |||||| |||||||| ||||||| |||||||| |||||||| || ||||||||||| |||
Sbjct: 904 tctcctcatcccaggggctattataaatgtagtagcatgagaggctgccctgcaaggaag 963

                      
Query: 739 catgtggaaag 749
           ||||| |||||
Sbjct: 964 catgttgaaag 974


>29644.m000187 hypothetical protein
          Length = 318

 Score = 75.8 bits (38), Expect = 5e-13
 Identities = 62/70 (88%)
 Strand = Plus / Plus

                                                                       
Query: 620 ctgatataccaccagatgattatacttggagaaaatatggacagaaacccataaagggat 679
           ||||||||||||| ||||||||| |||||||||| ||||| || |||||||| || ||||
Sbjct: 86  ctgatataccaccggatgattattcttggagaaagtatgggcaaaaacccattaaaggat 145

                     
Query: 680 ctccttatcc 689
           ||||| ||||
Sbjct: 146 ctcctcatcc 155


>30076.m004648 conserved hypothetical protein
          Length = 798

 Score = 71.9 bits (36), Expect = 7e-12
 Identities = 54/60 (90%)
 Strand = Plus / Plus

                                                                       
Query: 644 cttggagaaaatatggacagaaacccataaagggatctccttatcccaggagctattaca 703
           |||||||||||||||| |||||||| || || |||||||||||||| ||| |||||||||
Sbjct: 167 cttggagaaaatatggccagaaaccaattaaaggatctccttatccaaggggctattaca 226


>29598.m000445 WRKY transcription factor, putative
          Length = 792

 Score = 61.9 bits (31), Expect = 7e-09
 Identities = 88/107 (82%)
 Strand = Plus / Plus

                                                                       
Query: 646 tggagaaaatatggacagaaacccataaagggatctccttatcccaggagctattacaaa 705
           |||||||||||||| || || || || ||||| |||||  |||| ||| | || ||||||
Sbjct: 598 tggagaaaatatgggcaaaagccgattaagggctctccacatcctaggggatactacaaa 657

                                                          
Query: 706 tgtagcagcatgaggggttgccctgcaagaaagcatgtggaaagatg 752
           ||||||||| | || |||||||| ||||| |||||||| || |||||
Sbjct: 658 tgtagcagccttagaggttgcccagcaaggaagcatgtcgagagatg 704