Jatropha Genome Database
- JcCB0001101.20
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCB0001101.20 + phase: 0
(237 letters)
Database: castor_wgs_0.1_cds
31,221 sequences; 31,347,911 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
29945.m000087 Ubiquinol-cytochrome c reductase complex ubiquinon... 107 3e-23
>29945.m000087 Ubiquinol-cytochrome c reductase complex
ubiquinone-binding protein QP-C, putative
Length = 279
Score = 107 bits (54), Expect = 3e-23
Identities = 114/134 (85%)
Strand = Plus / Plus
Query: 22 atgaaggcggtggtttacgctctttcgccatttcagcagaagataatgcctggtttatgg 81
|||||||| ||| | ||| | ||||| |||||||| |||||| ||||| | ||| | |||
Sbjct: 1 atgaaggcagtgatatactcactttcaccatttcaacagaaggtaatgacaggtctctgg 60
Query: 82 aaggatctgcctaacaagatccatcacaaggtgtcagagaactggatcagcgccaccctc 141
|| ||||| ||| |||||||||| |||||||| || |||||||||||||||||||| |||
Sbjct: 61 aaagatctccctgacaagatccaccacaaggtctccgagaactggatcagcgccacactc 120
Query: 142 cttctcacccctct 155
|||||| |||||||
Sbjct: 121 cttctcgcccctct 134