Jatropha Genome Database

JcCA0317741.20
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0317741.20 + phase: 0 
         (291 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30170.m013721 conserved hypothetical protein                          283   3e-76

>30170.m013721 conserved hypothetical protein
          Length = 297

 Score =  283 bits (143), Expect = 3e-76
 Identities = 238/269 (88%), Gaps = 3/269 (1%)
 Strand = Plus / Plus

                                                                       
Query: 7   agtaattggagaagaacactgggaaatgtgaggtcgtttatagggaattcgatgggagga 66
           ||||||||||| |||||||| ||||||||  |||||||||||||||||||||||||||| 
Sbjct: 10  agtaattggaggagaacactaggaaatgtccggtcgtttatagggaattcgatgggaggc 69

                                                                       
Query: 67  cttagaggaggaagtaatctcgcttcatgggtcgttgcgggaaccctagcctactttctc 126
           |||||||||||||| ||  |||| |||||||| ||||| ||||||||||| |||||||||
Sbjct: 70  cttagaggaggaagcaacatcgcatcatgggtggttgctggaaccctagcttactttctc 129

                                                                       
Query: 127 tgggtcaagccttcccaggacctcaagcgagaacaacaagaacgggcagcacttgcagct 186
           ||| |||||||||| |||||||||| |||||||||  | ||| |||||||| ||||||||
Sbjct: 130 tggatcaagccttctcaggacctcaggcgagaacaggaggaaagggcagcaattgcagct 189

                                                                       
Query: 187 g---cggatccttatcggtacgtcgagaaaagaaagccaatacctgatccgcaggaaacc 243
           |   ||||||||||||| || || |||||| |||| || ||||||||||| |||||||| 
Sbjct: 190 gcttcggatccttatcgatatgttgagaaacgaaaacccatacctgatccacaggaaacg 249

                                        
Query: 244 ggattgatatacggcaacaagaataaaac 272
           |||||||||||||||||||||||||||||
Sbjct: 250 ggattgatatacggcaacaagaataaaac 278