Jatropha Genome Database

JcCA0317631.30
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0317631.30 + phase: 0 /partial
         (178 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29904.m002980 Chalcone synthase, putative                              56   7e-08

>29904.m002980 Chalcone synthase, putative
          Length = 1173

 Score = 56.0 bits (28), Expect = 7e-08
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                       
Query: 151 gaacttaaagaaaagttcaagcgcatgt 178
           ||||||||||||||||||||||||||||
Sbjct: 151 gaacttaaagaaaagttcaagcgcatgt 178