Jatropha Genome Database

JcCA0317001.10
Show Alignment: 
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0317001.10 + phase: 0 /partial
         (267 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

28076.m000411 Aquaporin PIP2.1, putative                               86   1e-16
28962.m000435 conserved hypothetical protein                           74   5e-13
30078.m002337 Aquaporin PIP2.2, putative                               68   3e-11
29869.m001194 Aquaporin PIP2.7, putative                               62   2e-09
29969.m000266 Aquaporin PIP1.1, putative                               56   1e-07
29669.m000809 Aquaporin PIP1.3, putative                               52   2e-06

>28076.m000411 Aquaporin PIP2.1, putative
          Length = 864

 Score = 85.7 bits (43), Expect = 1e-16
 Identities = 85/99 (85%)
 Strand = Plus / Plus

                                                                       
Query: 73  actggcactgggatcaatcctgctagaagttttggagctgctgtcatttataacaagaag 132
           ||||||||||| ||||| |||||||| ||||||||||||||||| || ||||||||  | 
Sbjct: 673 actggcactggcatcaaccctgctaggagttttggagctgctgttatctataacaaagaa 732

                                                  
Query: 133 atggtttgggatgatcattggattttctgggtcggacca 171
           | ||  ||||||||||| ||||| |||||||| ||||||
Sbjct: 733 aaggcctgggatgatcagtggatcttctgggttggacca 771


>28962.m000435 conserved hypothetical protein
          Length = 264

 Score = 73.8 bits (37), Expect = 5e-13
 Identities = 76/89 (85%)
 Strand = Plus / Plus

                                                                       
Query: 10  gttttggctccgttgcctattggatttactgtgttcgtagtgcatatggccaccctcccc 69
           ||||||||||| ||||||||||||||| |||| | ||| |||||| |||||||  | || 
Sbjct: 73  gttttggctcctttgcctattggatttgctgtttccgttgtgcatttggccacgatacct 132

                                        
Query: 70  ataactggcactgggatcaatcctgctag 98
           || ||||| ||||| ||||||||||||||
Sbjct: 133 attactggtactggcatcaatcctgctag 161


>30078.m002337 Aquaporin PIP2.2, putative
          Length = 867

 Score = 67.9 bits (34), Expect = 3e-11
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 73  actggcactgggatcaatcctgctagaagttttggagctgctgtcatttataacaagaag 132
           ||||||||||| ||||| || || || ||||| ||||||||||| || || |||||| ||
Sbjct: 670 actggcactggaatcaacccagcaaggagtttcggagctgctgtaatctacaacaaggag 729

                                                 
Query: 133 atggtttgggatgatcattggattttctgggtcggacc 170
           | ||  |||||||| || |||||||||||||| |||||
Sbjct: 730 aaggcatgggatgaccagtggattttctgggttggacc 767


>29869.m001194 Aquaporin PIP2.7, putative
          Length = 843

 Score = 61.9 bits (31), Expect = 2e-09
 Identities = 94/115 (81%)
 Strand = Plus / Plus

                                                                       
Query: 65  tccccataactggcactgggatcaatcctgctagaagttttggagctgctgtcatttata 124
           ||||||| ||||| ||||| || || || || || || ||||||||||||||||| || |
Sbjct: 638 tccccatcactggtactggtattaacccagccaggagctttggagctgctgtcatctaca 697

                                                                  
Query: 125 acaagaagatggtttgggatgatcattggattttctgggtcggaccacttgttgg 179
           ||||  | |  || |||||||| ||||||||||||||||| |||||  |||||||
Sbjct: 698 acaatgacaaagtgtgggatgaccattggattttctgggttggaccttttgttgg 752


>29969.m000266 Aquaporin PIP1.1, putative
          Length = 867

 Score = 56.0 bits (28), Expect = 1e-07
 Identities = 31/32 (96%)
 Strand = Plus / Plus

                                           
Query: 139 tgggatgatcattggattttctgggtcggacc 170
           |||||||||||||||||||||||||| |||||
Sbjct: 763 tgggatgatcattggattttctgggtaggacc 794


>29669.m000809 Aquaporin PIP1.3, putative
          Length = 867

 Score = 52.0 bits (26), Expect = 2e-06
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 139 tgggatgatcattggattttctgggt 164
           ||||||||||||||||||||||||||
Sbjct: 763 tgggatgatcattggattttctgggt 788