Jatropha Genome Database
- JcCA0317001.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCA0317001.10 + phase: 0 /partial
(267 letters)
Database: castor_wgs_0.1_cds
31,221 sequences; 31,347,911 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
28076.m000411 Aquaporin PIP2.1, putative 86 1e-16
28962.m000435 conserved hypothetical protein 74 5e-13
30078.m002337 Aquaporin PIP2.2, putative 68 3e-11
29869.m001194 Aquaporin PIP2.7, putative 62 2e-09
29969.m000266 Aquaporin PIP1.1, putative 56 1e-07
29669.m000809 Aquaporin PIP1.3, putative 52 2e-06
>28076.m000411 Aquaporin PIP2.1, putative
Length = 864
Score = 85.7 bits (43), Expect = 1e-16
Identities = 85/99 (85%)
Strand = Plus / Plus
Query: 73 actggcactgggatcaatcctgctagaagttttggagctgctgtcatttataacaagaag 132
||||||||||| ||||| |||||||| ||||||||||||||||| || |||||||| |
Sbjct: 673 actggcactggcatcaaccctgctaggagttttggagctgctgttatctataacaaagaa 732
Query: 133 atggtttgggatgatcattggattttctgggtcggacca 171
| || ||||||||||| ||||| |||||||| ||||||
Sbjct: 733 aaggcctgggatgatcagtggatcttctgggttggacca 771
>28962.m000435 conserved hypothetical protein
Length = 264
Score = 73.8 bits (37), Expect = 5e-13
Identities = 76/89 (85%)
Strand = Plus / Plus
Query: 10 gttttggctccgttgcctattggatttactgtgttcgtagtgcatatggccaccctcccc 69
||||||||||| ||||||||||||||| |||| | ||| |||||| ||||||| | ||
Sbjct: 73 gttttggctcctttgcctattggatttgctgtttccgttgtgcatttggccacgatacct 132
Query: 70 ataactggcactgggatcaatcctgctag 98
|| ||||| ||||| ||||||||||||||
Sbjct: 133 attactggtactggcatcaatcctgctag 161
>30078.m002337 Aquaporin PIP2.2, putative
Length = 867
Score = 67.9 bits (34), Expect = 3e-11
Identities = 82/98 (83%)
Strand = Plus / Plus
Query: 73 actggcactgggatcaatcctgctagaagttttggagctgctgtcatttataacaagaag 132
||||||||||| ||||| || || || ||||| ||||||||||| || || |||||| ||
Sbjct: 670 actggcactggaatcaacccagcaaggagtttcggagctgctgtaatctacaacaaggag 729
Query: 133 atggtttgggatgatcattggattttctgggtcggacc 170
| || |||||||| || |||||||||||||| |||||
Sbjct: 730 aaggcatgggatgaccagtggattttctgggttggacc 767
>29869.m001194 Aquaporin PIP2.7, putative
Length = 843
Score = 61.9 bits (31), Expect = 2e-09
Identities = 94/115 (81%)
Strand = Plus / Plus
Query: 65 tccccataactggcactgggatcaatcctgctagaagttttggagctgctgtcatttata 124
||||||| ||||| ||||| || || || || || || ||||||||||||||||| || |
Sbjct: 638 tccccatcactggtactggtattaacccagccaggagctttggagctgctgtcatctaca 697
Query: 125 acaagaagatggtttgggatgatcattggattttctgggtcggaccacttgttgg 179
|||| | | || |||||||| ||||||||||||||||| ||||| |||||||
Sbjct: 698 acaatgacaaagtgtgggatgaccattggattttctgggttggaccttttgttgg 752
>29969.m000266 Aquaporin PIP1.1, putative
Length = 867
Score = 56.0 bits (28), Expect = 1e-07
Identities = 31/32 (96%)
Strand = Plus / Plus
Query: 139 tgggatgatcattggattttctgggtcggacc 170
|||||||||||||||||||||||||| |||||
Sbjct: 763 tgggatgatcattggattttctgggtaggacc 794
>29669.m000809 Aquaporin PIP1.3, putative
Length = 867
Score = 52.0 bits (26), Expect = 2e-06
Identities = 26/26 (100%)
Strand = Plus / Plus
Query: 139 tgggatgatcattggattttctgggt 164
||||||||||||||||||||||||||
Sbjct: 763 tgggatgatcattggattttctgggt 788