Jatropha Genome Database

JcCA0316521.20
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0316521.20 + phase: 0 
         (1398 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

27471.m000424 conserved hypothetical protein                          127   2e-28

>27471.m000424 conserved hypothetical protein
          Length = 1494

 Score =  127 bits (64), Expect = 2e-28
 Identities = 157/188 (83%)
 Strand = Plus / Plus

                                                                       
Query: 255 atggaagagtcctcccaaacttgttctcagttatgactggcacgttggagcaggtgaaga 314
           ||||||| ||||||||||| | ||||| ||| |  ||||||| |||| ||| ||||||||
Sbjct: 108 atggaagtgtcctcccaaagtggttctgagtcacaactggcatgttgcagctggtgaaga 167

                                                                       
Query: 315 aagcctagaggcaaaggctcaaaaactgagggaaatgagagtgcttgaagcagtttttcc 374
           |||    |||||  ||||||||||| | |||||||| |||||||||||||| ||||||||
Sbjct: 168 aagtactgaggctgaggctcaaaaagtcagggaaataagagtgcttgaagctgtttttcc 227

                                                                       
Query: 375 acgcccttctgctattcctcctggcccgtctatttcattggacatagaagaggaatatta 434
           ||| |  || || ||||||||| | || ||||||||||||||| |||||||||||| |||
Sbjct: 228 acgtcagtcagccattcctcctagtccctctatttcattggacgtagaagaggaatttta 287

                   
Query: 435 cgatgata 442
           | ||||||
Sbjct: 288 caatgata 295