Jatropha Genome Database

JcCA0316511.20
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0316511.20 - phase: 2 /partial
         (199 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29825.m000324 pentatricopeptide repeat-containing protein, putative    78   2e-14

>29825.m000324 pentatricopeptide repeat-containing protein, putative
          Length = 1704

 Score = 77.8 bits (39), Expect = 2e-14
 Identities = 51/55 (92%)
 Strand = Plus / Plus

                                                                  
Query: 143 ggagttattactgcttgttgcaatgatctgaatttgattaggcagtttcattgtt 197
           ||||| |||||||||||||| |||||| ||||||||||||||||||| |||||||
Sbjct: 433 ggagtgattactgcttgttgtaatgatgtgaatttgattaggcagttacattgtt 487