Jatropha Genome Database

JcCA0316341.30
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0316341.30 - phase: 1 /pseudo/partial
         (239 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30154.m001149 fructose-bisphosphate aldolase, putative                 90   7e-18

>30154.m001149 fructose-bisphosphate aldolase, putative
          Length = 1074

 Score = 89.7 bits (45), Expect = 7e-18
 Identities = 80/89 (89%), Gaps = 2/89 (2%)
 Strand = Plus / Plus

                                                                        
Query: 132  ttcttggtgaggtgcaa-agctaattctgatgcaactcttggaaagtacaccggaggtgg 190
            ||||||||||||||||| ||| |||||||| ||||||||||| |||||||| ||||| ||
Sbjct: 964  ttcttggtgaggtgcaagagc-aattctgaagcaactcttgggaagtacactggaggagg 1022

                                         
Query: 191  tgctggtggtttggcttctgaaagcttgt 219
            |||| |||| ||||||||||| |||||||
Sbjct: 1023 tgctagtgggttggcttctgagagcttgt 1051