Jatropha Genome Database

JcCA0316311.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0316311.10 - phase: 0 /pseudo
         (764 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

28693.m000103 Pre-rRNA-processing protein ESF1, putative              100   2e-20

>28693.m000103 Pre-rRNA-processing protein ESF1, putative
          Length = 2169

 Score = 99.6 bits (50), Expect = 2e-20
 Identities = 74/82 (90%)
 Strand = Plus / Plus

                                                                       
Query: 604 gtagaggtggaaaatataccaacaattgaagatggaacccgcaggcttgcggttgttaat 663
           ||||||||||||||||| |||||||||||||||||||| |  |||||||| |||||||||
Sbjct: 526 gtagaggtggaaaatattccaacaattgaagatggaactcataggcttgctgttgttaat 585

                                 
Query: 664 atggactggaggcatgtaaggg 685
            |||| ||||||||||| ||||
Sbjct: 586 ctggattggaggcatgttaggg 607