Jatropha Genome Database

JcCA0315721.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0315721.10 + phase: 0 
         (603 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

28153.m000277 conserved hypothetical protein                           70   2e-11

>28153.m000277 conserved hypothetical protein
          Length = 438

 Score = 69.9 bits (35), Expect = 2e-11
 Identities = 107/131 (81%)
 Strand = Plus / Minus

                                                                       
Query: 440 attgttgtaggtggttgaatgaattagatgacgagtgtgtctgcgagctgctggttcgct 499
           ||||||| | |||| ||||| | |||||||| |||||||| ||||  ||||||||||| |
Sbjct: 159 attgttgcaagtggctgaatcagttagatgatgagtgtgtttgcggcctgctggttcgtt 100

                                                                       
Query: 500 tgccgcccttcctctcaaggcctgcacatgtttatactctctatcttgatgagtcatgca 559
           |||| || | |||||| |||| ||| |||   |||||||||||  |||||||||| ||||
Sbjct: 99  tgccaccatccctctccaggcttgcccataggtatactctctacgttgatgagtcctgca 40

                      
Query: 560 atgtaacttat 570
             |||||||||
Sbjct: 39  gcgtaacttat 29