Jatropha Genome Database

JcCA0315581.30
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0315581.30 - phase: 0 /TE/partial
         (999 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29674.m000206 conserved hypothetical protein                           52   7e-06

>29674.m000206 conserved hypothetical protein
          Length = 1491

 Score = 52.0 bits (26), Expect = 7e-06
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                              
Query: 772  gaagatgtacttgtaaaggtaggcacatttatcttccctgttgattttgt 821
            |||||||||||| |||||||||  | ||||||||| ||||| ||||||||
Sbjct: 991  gaagatgtacttataaaggtagataaatttatctttcctgtggattttgt 1040