Jatropha Genome Database

JcCA0312601.30
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0312601.30 + phase: 0 
         (168 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29827.m002604 conserved hypothetical protein                          143   4e-34

>29827.m002604 conserved hypothetical protein
          Length = 207

 Score =  143 bits (72), Expect = 4e-34
 Identities = 105/116 (90%)
 Strand = Plus / Plus

                                                                       
Query: 8   gaggaaagcagaagatcgaagcccaaaggaaaaatgcagagaggaatcagaaggcaaagg 67
           |||| ||||||||||||||||| ||||||| |||||||||||||||||| ||| |||| |
Sbjct: 8   gagggaagcagaagatcgaagcacaaaggagaaatgcagagaggaatcaaaagccaaaag 67

                                                                   
Query: 68  gctctcagcttgaagccagagctgtcgctctcaaagtcagctgccccatctgcaag 123
           | ||||||||||| || |||||||| ||||||||||||| ||||||||||||||||
Sbjct: 68  ggtctcagcttgaggctagagctgttgctctcaaagtcatctgccccatctgcaag 123