Jatropha Genome Database

JcCA0311881.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0311881.10 + phase: 2 /partial/short
         (133 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29739.m003706 conserved hypothetical protein                           64   2e-10

>29739.m003706 conserved hypothetical protein
          Length = 303

 Score = 63.9 bits (32), Expect = 2e-10
 Identities = 65/76 (85%)
 Strand = Plus / Plus

                                                                       
Query: 44  ttctttgttgctggagtctttgttggttacacgttgaaaagtcgtgttaagagatgggct 103
           |||||| ||||||||||  |||| |||||||| ||||| || ||||||   |||||||||
Sbjct: 211 ttctttattgctggagttcttgtaggttacacattgaagagacgtgttcgcagatgggct 270

                           
Query: 104 tccaagcttctcaaga 119
           || |||||||||||||
Sbjct: 271 tctaagcttctcaaga 286