Jatropha Genome Database
- JcCA0311501.30
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCA0311501.30 - phase: 1 /partial
(386 letters)
Database: castor_wgs_0.1_cds
31,221 sequences; 31,347,911 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
29883.m001967 cyclophilin, putative 145 2e-34
>29883.m001967 cyclophilin, putative
Length = 2067
Score = 145 bits (73), Expect = 2e-34
Identities = 166/197 (84%)
Strand = Plus / Plus
Query: 42 agcatttctcgtagtccaggcagttatcgtggccgttacagggatcaaagccggagtcag 101
|||| |||||| |||||||| ||| ||| | |||| | ||||||||| ||||||| |||
Sbjct: 1738 agcacttctcgcagtccaggaagtcatcatcgccgccatagggatcaacgccggagccag 1797
Query: 102 agtccaattcgcagtcctagtcctagagataagcgaccttcaataagtgagggtctgaaa 161
|||||| |||||||||||||||||||||| | | ||||| | ||||||||||||||||||
Sbjct: 1798 agtccagttcgcagtcctagtcctagagacaggagacctgccataagtgagggtctgaaa 1857
Query: 162 tcgcgtctgggcccccgaattgatgatcaacgctcattgaacaaaggaagattgaggtcc 221
|| || ||||| |||||||| ||||||| ||| | || ||| ||||||||| ||||||
Sbjct: 1858 tctcgactgggtccccgaatggatgatcggcgccctatggacagaggaagattaaggtcc 1917
Query: 222 agttctaggtccaggag 238
||||| ||||| |||||
Sbjct: 1918 agttccaggtctaggag 1934