Jatropha Genome Database

JcCA0311501.10
Show Alignment: 
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0311501.10 - phase: 0 /partial
         (646 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29883.m001970 ammonium transporter, putative                          274   6e-73
29848.m004664 ammonium transporter, putative                           74   1e-12
29826.m000743 ammonium transporter, putative                           74   1e-12
29784.m000373 ammonium transporter, putative                           52   4e-06

>29883.m001970 ammonium transporter, putative
          Length = 1440

 Score =  274 bits (138), Expect = 6e-73
 Identities = 241/274 (87%), Gaps = 1/274 (0%)
 Strand = Plus / Plus

                                                                       
Query: 334 gggaaatttcctagtgctacgatggtgtatttccagtttgtttttgctgccataacattg 393
           ||||||||||| | ||| || ||| | ||||| |||||||| |||||||| |||||| ||
Sbjct: 331 gggaaatttccaaatgcaacaatgatatattttcagtttgtatttgctgctataacactg 390

                                                                       
Query: 394 attttggttgctggagcgctgcttgggaggatgaactttcatgcatggatgctttttgtg 453
           |||||||| || || ||  |||||||||||||||| ||||||||||||||||| ||||| 
Sbjct: 391 attttggtggcgggggcattgcttgggaggatgaattttcatgcatggatgctgtttgta 450

                                                                       
Query: 454 ccactttggctcactttctcttatactattactgcttatagcatatggtgcccaactggg 513
           || ||||||||||| || ||||||||||||||||||||||| || |||||||||||||| 
Sbjct: 451 cccctttggctcaccttttcttatactattactgcttatagtatttggtgcccaactggt 510

                                                                       
Query: 514 tggctggctaaaatgggaattatagattactctggaggatatgtcattcaccttgcatct 573
           ||| ||||||| |||||||||||||||||||||||||||||||| ||||| ||| |||| 
Sbjct: 511 tggttggctaagatgggaattatagattactctggaggatatgttattcatctttcatc- 569

                                             
Query: 574 gggggttgctggtttcactgcagccttttgggta 607
           ||| |||||||||||||||||||| | |||||||
Sbjct: 570 gggtgttgctggtttcactgcagcttattgggta 603



 Score =  141 bits (71), Expect = 6e-33
 Identities = 173/207 (83%)
 Strand = Plus / Plus

                                                                       
Query: 40  gacgatgccagcccggaatggatgaacaaagccgacaatgcatggcagctaacggcggca 99
           |||||||| ||||| || ||| ||| |||||||||||||||||||||||| ||||| |||
Sbjct: 40  gacgatgctagcccagactggttgagcaaagccgacaatgcatggcagctcacggcagca 99

                                                                       
Query: 100 accctagtaggccttcagagcgtgccaggcttagtcattctttacggaagcattgttaaa 159
           || ||||| ||||| ||||| || || ||||| || || ||||| ||||| || || |||
Sbjct: 100 actctagtgggcctccagagtgtaccgggcttggtaatactttatggaagtatagtgaaa 159

                                                                       
Query: 160 aagaaatgggctgtgaactccgccttcatggccctatacgcgttcgcagcggttctggta 219
           |||||||||||||| ||||| || ||||||||||| || || ||||| ||||| ||||| 
Sbjct: 160 aagaaatgggctgtcaactcagcattcatggccctgtatgccttcgcggcggtgctggtg 219

                                      
Query: 220 tgctgggtggggtggggttaccagatg 246
           || ||||| || ||||| |||| ||||
Sbjct: 220 tgttgggttggctggggataccggatg 246


>29848.m004664 ammonium transporter, putative
          Length = 1479

 Score = 73.8 bits (37), Expect = 1e-12
 Identities = 88/105 (83%)
 Strand = Plus / Plus

                                                                       
Query: 340 tttcctagtgctacgatggtgtatttccagtttgtttttgctgccataacattgattttg 399
           ||||||| ||| || ||||||| |||||| | ||||||||| || || || |||||||||
Sbjct: 373 tttcctactgcaaccatggtgtttttccaatctgtttttgcagcgattactttgattttg 432

                                                        
Query: 400 gttgctggagcgctgcttgggaggatgaactttcatgcatggatg 444
            ||||||| ||  |||||||||||||||| ||| |||| ||||||
Sbjct: 433 attgctggtgccttgcttgggaggatgaatttttatgcttggatg 477


>29826.m000743 ammonium transporter, putative
          Length = 1470

 Score = 73.8 bits (37), Expect = 1e-12
 Identities = 91/109 (83%)
 Strand = Plus / Plus

                                                                       
Query: 372 tgtttttgctgccataacattgattttggttgctggagcgctgcttgggaggatgaactt 431
           |||||||||||| |||||| |||||||| |||  ||| || | ||||||||||||||  |
Sbjct: 435 tgtttttgctgctataacactgattttgcttgggggatcggttcttgggaggatgaatat 494

                                                            
Query: 432 tcatgcatggatgctttttgtgccactttggctcactttctcttatact 480
             | |||||||||  |||||||||||| |||||||| || |||||||||
Sbjct: 495 aaaggcatggatggcttttgtgccactctggctcacgttttcttatact 543


>29784.m000373 ammonium transporter, putative
          Length = 1410

 Score = 52.0 bits (26), Expect = 4e-06
 Identities = 71/86 (82%)
 Strand = Plus / Plus

                                                                       
Query: 367 cagtttgtttttgctgccataacattgattttggttgctggagcgctgcttgggaggatg 426
           ||||||| |||||||||||| ||  | |||||| | |||||| |  | ||||||||||||
Sbjct: 376 cagtttgcttttgctgccattactgttattttgctagctggatctttacttgggaggatg 435

                                     
Query: 427 aactttcatgcatggatgctttttgt 452
           ||| |  |||| ||||||||||||||
Sbjct: 436 aacatctatgcttggatgctttttgt 461