Jatropha Genome Database
- JcCA0311501.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCA0311501.10 - phase: 0 /partial
(646 letters)
Database: castor_wgs_0.1_cds
31,221 sequences; 31,347,911 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
29883.m001970 ammonium transporter, putative 274 6e-73
29848.m004664 ammonium transporter, putative 74 1e-12
29826.m000743 ammonium transporter, putative 74 1e-12
29784.m000373 ammonium transporter, putative 52 4e-06
>29883.m001970 ammonium transporter, putative
Length = 1440
Score = 274 bits (138), Expect = 6e-73
Identities = 241/274 (87%), Gaps = 1/274 (0%)
Strand = Plus / Plus
Query: 334 gggaaatttcctagtgctacgatggtgtatttccagtttgtttttgctgccataacattg 393
||||||||||| | ||| || ||| | ||||| |||||||| |||||||| |||||| ||
Sbjct: 331 gggaaatttccaaatgcaacaatgatatattttcagtttgtatttgctgctataacactg 390
Query: 394 attttggttgctggagcgctgcttgggaggatgaactttcatgcatggatgctttttgtg 453
|||||||| || || || |||||||||||||||| ||||||||||||||||| |||||
Sbjct: 391 attttggtggcgggggcattgcttgggaggatgaattttcatgcatggatgctgtttgta 450
Query: 454 ccactttggctcactttctcttatactattactgcttatagcatatggtgcccaactggg 513
|| ||||||||||| || ||||||||||||||||||||||| || ||||||||||||||
Sbjct: 451 cccctttggctcaccttttcttatactattactgcttatagtatttggtgcccaactggt 510
Query: 514 tggctggctaaaatgggaattatagattactctggaggatatgtcattcaccttgcatct 573
||| ||||||| |||||||||||||||||||||||||||||||| ||||| ||| ||||
Sbjct: 511 tggttggctaagatgggaattatagattactctggaggatatgttattcatctttcatc- 569
Query: 574 gggggttgctggtttcactgcagccttttgggta 607
||| |||||||||||||||||||| | |||||||
Sbjct: 570 gggtgttgctggtttcactgcagcttattgggta 603
Score = 141 bits (71), Expect = 6e-33
Identities = 173/207 (83%)
Strand = Plus / Plus
Query: 40 gacgatgccagcccggaatggatgaacaaagccgacaatgcatggcagctaacggcggca 99
|||||||| ||||| || ||| ||| |||||||||||||||||||||||| ||||| |||
Sbjct: 40 gacgatgctagcccagactggttgagcaaagccgacaatgcatggcagctcacggcagca 99
Query: 100 accctagtaggccttcagagcgtgccaggcttagtcattctttacggaagcattgttaaa 159
|| ||||| ||||| ||||| || || ||||| || || ||||| ||||| || || |||
Sbjct: 100 actctagtgggcctccagagtgtaccgggcttggtaatactttatggaagtatagtgaaa 159
Query: 160 aagaaatgggctgtgaactccgccttcatggccctatacgcgttcgcagcggttctggta 219
|||||||||||||| ||||| || ||||||||||| || || ||||| ||||| |||||
Sbjct: 160 aagaaatgggctgtcaactcagcattcatggccctgtatgccttcgcggcggtgctggtg 219
Query: 220 tgctgggtggggtggggttaccagatg 246
|| ||||| || ||||| |||| ||||
Sbjct: 220 tgttgggttggctggggataccggatg 246
>29848.m004664 ammonium transporter, putative
Length = 1479
Score = 73.8 bits (37), Expect = 1e-12
Identities = 88/105 (83%)
Strand = Plus / Plus
Query: 340 tttcctagtgctacgatggtgtatttccagtttgtttttgctgccataacattgattttg 399
||||||| ||| || ||||||| |||||| | ||||||||| || || || |||||||||
Sbjct: 373 tttcctactgcaaccatggtgtttttccaatctgtttttgcagcgattactttgattttg 432
Query: 400 gttgctggagcgctgcttgggaggatgaactttcatgcatggatg 444
||||||| || |||||||||||||||| ||| |||| ||||||
Sbjct: 433 attgctggtgccttgcttgggaggatgaatttttatgcttggatg 477
>29826.m000743 ammonium transporter, putative
Length = 1470
Score = 73.8 bits (37), Expect = 1e-12
Identities = 91/109 (83%)
Strand = Plus / Plus
Query: 372 tgtttttgctgccataacattgattttggttgctggagcgctgcttgggaggatgaactt 431
|||||||||||| |||||| |||||||| ||| ||| || | |||||||||||||| |
Sbjct: 435 tgtttttgctgctataacactgattttgcttgggggatcggttcttgggaggatgaatat 494
Query: 432 tcatgcatggatgctttttgtgccactttggctcactttctcttatact 480
| ||||||||| |||||||||||| |||||||| || |||||||||
Sbjct: 495 aaaggcatggatggcttttgtgccactctggctcacgttttcttatact 543
>29784.m000373 ammonium transporter, putative
Length = 1410
Score = 52.0 bits (26), Expect = 4e-06
Identities = 71/86 (82%)
Strand = Plus / Plus
Query: 367 cagtttgtttttgctgccataacattgattttggttgctggagcgctgcttgggaggatg 426
||||||| |||||||||||| || | |||||| | |||||| | | ||||||||||||
Sbjct: 376 cagtttgcttttgctgccattactgttattttgctagctggatctttacttgggaggatg 435
Query: 427 aactttcatgcatggatgctttttgt 452
||| | |||| ||||||||||||||
Sbjct: 436 aacatctatgcttggatgctttttgt 461