Jatropha Genome Database

JcCA0310371.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0310371.10 - phase: 0 
         (531 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29912.m005582 conserved hypothetical protein                           68   6e-11
29807.m000498 conserved hypothetical protein                           62   4e-09

>29912.m005582 conserved hypothetical protein
          Length = 423

 Score = 67.9 bits (34), Expect = 6e-11
 Identities = 148/186 (79%)
 Strand = Plus / Plus

                                                                       
Query: 270 caatctgttcgcagcggctagcgagggaatatgggacaatggggcggcctgtggaagaca 329
           |||||||||||| |||||  | ||||||||||||||||||||  |  ||||||| ||| |
Sbjct: 159 caatctgttcgcggcggccggagagggaatatgggacaatggttcatcctgtgggagaga 218

                                                                       
Query: 330 atacttggtaagatgcatcagtgcagttgctcctaacacttgcaatcgagagaaaatcat 389
           |||||  ||||| ||||| ||||||| || || |   || ||||| | |||  | | |||
Sbjct: 219 atactatgtaagttgcattagtgcagctgttcgtggaacatgcaaaccagaccagaccat 278

                                                                       
Query: 390 tcgggtaaggattgtagatcgcgcacaaacttctgtgtctagaccttcaagaaatggtgc 449
           |||||| | |||||| ||||| || |||||||||||  |||||||||| |||  ||||||
Sbjct: 279 tcgggttaagattgttgatcgtgctcaaacttctgttactagaccttctagacctggtgc 338

                 
Query: 450 aaccat 455
            |||||
Sbjct: 339 taccat 344


>29807.m000498 conserved hypothetical protein
          Length = 570

 Score = 61.9 bits (31), Expect = 4e-09
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                      
Query: 295 ggaatatgggacaatggggcggcctgtggaagacaatacttggtaagatgcatcagtgc 353
           ||||||||||||||||||||  | ||||||||| |||| ||||| || |||||||||||
Sbjct: 202 ggaatatgggacaatggggcttcgtgtggaagagaatatttggtgaggtgcatcagtgc 260