Jatropha Genome Database

JcCA0309871.30
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0309871.30 + phase: 0 
         (765 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30099.m001728 conserved hypothetical protein                           72   5e-12
30099.m001727 conserved hypothetical protein                           64   1e-09
30099.m001726 conserved hypothetical protein                           64   1e-09

>30099.m001728 conserved hypothetical protein
          Length = 1248

 Score = 71.9 bits (36), Expect = 5e-12
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 690 acttcaaaacaagcatttacttgacttgcaccgaaacatc 729
           |||||||||||||||||||||||||||||| |||||||||
Sbjct: 639 acttcaaaacaagcatttacttgacttgcaacgaaacatc 678



 Score = 58.0 bits (29), Expect = 8e-08
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                    
Query: 409 atgttgattattgatggttgcttcataatagagttctttcg 449
           ||||||||||||||||||||||| || |||||||| |||||
Sbjct: 361 atgttgattattgatggttgctttattatagagttatttcg 401


>30099.m001727 conserved hypothetical protein
          Length = 1254

 Score = 63.9 bits (32), Expect = 1e-09
 Identities = 38/40 (95%)
 Strand = Plus / Plus

                                                   
Query: 697 aacaagcatttacttgacttgcaccgaaacatcttgcttt 736
           ||||||||||||||||||||||| ||||||||| ||||||
Sbjct: 652 aacaagcatttacttgacttgcaacgaaacatcatgcttt 691


>30099.m001726 conserved hypothetical protein
          Length = 1254

 Score = 63.9 bits (32), Expect = 1e-09
 Identities = 38/40 (95%)
 Strand = Plus / Plus

                                                   
Query: 697 aacaagcatttacttgacttgcaccgaaacatcttgcttt 736
           ||||||||||||||||||||||| ||||||||| ||||||
Sbjct: 652 aacaagcatttacttgacttgcaacgaaacatcatgcttt 691