Jatropha Genome Database

JcCA0309151.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0309151.10 + phase: 1 /pseudo/partial
         (2605 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30131.m007017 serine-threonine protein kinase, plant-type, putative    94   5e-18
29630.m000826 receptor-kinase, putative                                56   1e-06

>30131.m007017 serine-threonine protein kinase, plant-type, putative
          Length = 1803

 Score = 93.7 bits (47), Expect = 5e-18
 Identities = 140/171 (81%)
 Strand = Plus / Plus

                                                                        
Query: 1782 aaggagcttacaagagcttcatggcagagtgcaaggcgctaagaaatactagacaacgaa 1841
            |||| |||| |||||||||||||||||| ||||| ||  |||| |||    | || ||||
Sbjct: 926  aaggtgcttccaagagcttcatggcagaatgcaacgcattaaggaatgtacggcatcgaa 985

                                                                        
Query: 1842 atcttgttaagttattaacatactgctctagtattgattaccaacgaaatgaattcaaag 1901
            ||||||| ||| |||||||||| ||||| ||  | |||||| ||| ||||||||||||||
Sbjct: 986  atcttgtcaagctattaacatattgctccagcttggattacaaacaaaatgaattcaaag 1045

                                                               
Query: 1902 ctcttgttttcgaatttatcgaaaatgggagccttgagaagtggttgcatc 1952
            ||||  |||| ||||| || |||||||| || || ||||| ||||||||||
Sbjct: 1046 ctctaatttttgaattcatggaaaatggaagtctagagaattggttgcatc 1096



 Score = 63.9 bits (32), Expect = 5e-09
 Identities = 41/44 (93%)
 Strand = Plus / Plus

                                                        
Query: 2066 atcattcactctgacttaaagccgagcaatgttcttcttgatga 2109
            |||||||| | ||||||||||||||||||||||||||| |||||
Sbjct: 1216 atcattcattgtgacttaaagccgagcaatgttcttctggatga 1259


>29630.m000826 receptor-kinase, putative
          Length = 3102

 Score = 56.0 bits (28), Expect = 1e-06
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                    
Query: 2053 ttgtgaaacaacaatcattcactctgacttaaagccgagcaatgttcttcttgatg 2108
            ||||||||| |||||  |||||| |||| | ||||||||||| |||||||||||||
Sbjct: 2496 ttgtgaaactacaatagttcactgtgacctgaagccgagcaacgttcttcttgatg 2551