Jatropha Genome Database

JcCA0308831.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0308831.10 - phase: 0 
         (456 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29739.m003744 conserved hypothetical protein                           56   2e-07

>29739.m003744 conserved hypothetical protein
          Length = 459

 Score = 56.0 bits (28), Expect = 2e-07
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 413 cattagttcgatccgaaagttgtttttctgctttgtctcgttga 456
           ||||||||||||| |  |||||||| ||||||||||||||||||
Sbjct: 416 cattagttcgatctgggagttgtttctctgctttgtctcgttga 459