Jatropha Genome Database

JcCA0308281.20
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0308281.20 - phase: 0 
         (465 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29751.m001814 conserved hypothetical protein                          244   4e-64

>29751.m001814 conserved hypothetical protein
          Length = 495

 Score =  244 bits (123), Expect = 4e-64
 Identities = 213/243 (87%)
 Strand = Plus / Plus

                                                                       
Query: 153 aaagaagaagaacctgtttgaggttgctcagtttttacccaattggggaattggttacca 212
           ||||||||||||  |  ||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 180 aaagaagaagaatttagttgaggtggctcagtttttacccaattggggaattggttacca 239

                                                                       
Query: 213 catggctaaatctcattggaaaaatgtttcttatgagatcaccaagatcaatctctacaa 272
           | | || ||||||||||||||  | || |||||||| ||||||||||| |||||||||||
Sbjct: 240 ctttgccaaatctcattggaatgaagtctcttatgaaatcaccaagattaatctctacaa 299

                                                                       
Query: 273 ggatggtagacatggaaaagcgtgggggattgcttacaaagacggagctccagctgcaga 332
           ||||||||  ||||||||||| |||||||||||| ||||| |||||   |||  ||| ||
Sbjct: 300 ggatggtaagcatggaaaagcttgggggattgctcacaaaaacggattaccaattgctga 359

                                                                       
Query: 333 aactcccaagaagataagtggagtccataagcgttgctggagatacattccaagcttaac 392
             |||| ||||||||||||||||| ||||||||||||||||||||||||||||||||| |
Sbjct: 360 tgctcctaagaagataagtggagttcataagcgttgctggagatacattccaagcttatc 419

              
Query: 393 aaa 395
           |||
Sbjct: 420 aaa 422