Jatropha Genome Database

JcCA0308171.30
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0308171.30 - phase: 0 /pseudo/partial
         (585 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30170.m013758 transcription initiation factor, putative               163   1e-39
29751.m001874 transcription initiation factor, putative               153   1e-36

>30170.m013758 transcription initiation factor, putative
          Length = 2778

 Score =  163 bits (82), Expect = 1e-39
 Identities = 202/242 (83%)
 Strand = Plus / Plus

                                                                        
Query: 178  gaggatgacaaaatgaggacaacggctgcaaatgttgctgctcgagctgctgttggtggc 237
            ||||||||||||||||| ||||| ||||||||||||||||| ||||| ||||||||||| 
Sbjct: 2362 gaggatgacaaaatgagaacaactgctgcaaatgttgctgcccgagcagctgttggtgga 2421

                                                                        
Query: 238  gacgacatgctttcaaagtggcaactcatggcagagcaagcgcgccagagacgggaaggt 297
            || |||   || ||||| |||||||||||||| |||||||| ||||||| ||| ||||||
Sbjct: 2422 gatgaccatctatcaaaatggcaactcatggctgagcaagcccgccagaaacgtgaaggt 2481

                                                                        
Query: 298  ggaaatgaggcaacttccagttcccagtcagctaaagacgttggccacaaccctcggtca 357
            || |  |||||  | ||  ||||| | ||||||||||| |||  || ||| ||||  |  
Sbjct: 2482 gggatagaggcggcatcaggttcctactcagctaaagaagttacccgcaagcctcaattt 2541

                                                                        
Query: 358  acatctggaagaaatatgaaggataatcaagaaccagaaaagaggagctctgcagctgca 417
            |||||||||| || ||||||||||||||| ||||| |||||||||||| |||| ||||||
Sbjct: 2542 acatctggaaaaagtatgaaggataatcaggaacctgaaaagaggagccctgcggctgca 2601

              
Query: 418  tc 419
            ||
Sbjct: 2602 tc 2603


>29751.m001874 transcription initiation factor, putative
          Length = 2784

 Score =  153 bits (77), Expect = 1e-36
 Identities = 158/185 (85%)
 Strand = Plus / Plus

                                                                        
Query: 111  taatgaagttgaagttgataatgagaaagatgacagtcatgcaaaatcagtgaagacgaa 170
            ||||||||| |||| ||| || |||||||| ||  ||| ||||||| |||| ||| | | 
Sbjct: 2166 taatgaagtggaaggtgacaaggagaaagacgaaggtcgtgcaaaaccagttaaggcaag 2225

                                                                        
Query: 171  cagagatgaggatgacaaaatgaggacaacggctgcaaatgttgctgctcgagctgctgt 230
            ||  || |||||||||||||||||||| || ||||||||||||||||| |||||||||||
Sbjct: 2226 caaggaagaggatgacaaaatgaggactacagctgcaaatgttgctgcccgagctgctgt 2285

                                                                        
Query: 231  tggtggcgacgacatgctttcaaagtggcaactcatggcagagcaagcgcgccagagacg 290
            |||||| || |||||||| |||||||||||||||||||  |||||||| ||||||| |||
Sbjct: 2286 tggtggagatgacatgctgtcaaagtggcaactcatggttgagcaagcccgccagaaacg 2345

                 
Query: 291  ggaag 295
             ||||
Sbjct: 2346 tgaag 2350



 Score = 63.9 bits (32), Expect = 1e-09
 Identities = 53/60 (88%)
 Strand = Plus / Plus

                                                                        
Query: 476  ccatttctgtcaaggatgtaattgccgtgctagaaagagaaccccagatgtccaagtcta 535
            |||| ||||| |||||||||||||| |  || |||||||||||||||||||| |||||||
Sbjct: 2537 ccatatctgttaaggatgtaattgcagcactggaaagagaaccccagatgtcaaagtcta 2596