Jatropha Genome Database
- JcCA0307631.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCA0307631.10 + phase: 0
(1482 letters)
Database: castor_wgs_0.1_cds
31,221 sequences; 31,347,911 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
29579.m000198 UDP-glucosyltransferase, putative 159 6e-38
29801.m003126 UDP-glucosyltransferase, putative 66 6e-10
30078.m002217 UDP-glucosyltransferase, putative 62 1e-08
30078.m002216 UDP-glucosyltransferase, putative 60 4e-08
29806.m000964 UDP-glucuronosyltransferase, putative 58 2e-07
29801.m003142 UDP-glucosyltransferase, putative 58 2e-07
29854.m001107 UDP-glucosyltransferase, putative 56 6e-07
29827.m002568 UDP-glucosyltransferase, putative 52 1e-05
29801.m003143 UDP-glucosyltransferase, putative 52 1e-05
>29579.m000198 UDP-glucosyltransferase, putative
Length = 1479
Score = 159 bits (80), Expect = 6e-38
Identities = 206/248 (83%)
Strand = Plus / Plus
Query: 979 gaaatagagaaatgggtttcagagactgggttcgaagagagaataaaaggaagaggtctt 1038
||||||||||||||| || ||||| ||| || || |||||| |||||||||||||||
Sbjct: 976 gaaatagagaaatggattgaagagagtggatttgagcagagaacgaaaggaagaggtctt 1035
Query: 1039 ttcattagcggctgggcgccacaaatgctaatactgtcacacccagcaattggaggattt 1098
| ||| ||||||||||||||||| | || ||| | ||||| || ||||||||||| |||
Sbjct: 1036 ctgattcgcggctgggcgccacaagtactgatattatcacatcctgcaattggaggtttt 1095
Query: 1099 gtgacgcattgtggatggaattcaacattggaagcaataagctcaggtgtgccgatggct 1158
|||| ||||| || ||||||||||||||||||||||||| | || |||| |||| |
Sbjct: 1096 ctgacacattgcggttggaattcaacattggaagcaataactgccggattgcctatggtt 1155
Query: 1159 acatggccactttttgctgatcaatttattaatgagaagctagttattcaggtactgaag 1218
|||||||||||||| || || |||||| |||||||||| | ||| |||| |||||||||
Sbjct: 1156 acatggccacttttcgcggaccaattttgtaatgagaagttggttgttcaagtactgaag 1215
Query: 1219 attggtgt 1226
||||||||
Sbjct: 1216 attggtgt 1223
>29801.m003126 UDP-glucosyltransferase, putative
Length = 1164
Score = 65.9 bits (33), Expect = 6e-10
Identities = 39/41 (95%)
Strand = Plus / Plus
Query: 1087 attggaggatttgtgacgcattgtggatggaattcaacatt 1127
|||||||||||| |||| |||||||||||||||||||||||
Sbjct: 1075 attggaggatttatgactcattgtggatggaattcaacatt 1115
>30078.m002217 UDP-glucosyltransferase, putative
Length = 690
Score = 61.9 bits (31), Expect = 1e-08
Identities = 64/75 (85%)
Strand = Plus / Plus
Query: 1051 tgggcgccacaaatgctaatactgtcacacccagcaattggaggatttgtgacgcattgt 1110
|||||||||||| ||| |||| | || || ||||||||||||||||| |||| |||||
Sbjct: 247 tgggcgccacaagtgccaatattatctcatccagcaattggaggattcttgacccattgc 306
Query: 1111 ggatggaattcaaca 1125
|| ||||||||||||
Sbjct: 307 ggttggaattcaaca 321
>30078.m002216 UDP-glucosyltransferase, putative
Length = 1452
Score = 60.0 bits (30), Expect = 4e-08
Identities = 51/58 (87%)
Strand = Plus / Plus
Query: 1064 tgctaatactgtcacacccagcaattggaggatttgtgacgcattgtggatggaattc 1121
||||||| || |||||||| |||||||||||||| |||| |||||||| ||||||||
Sbjct: 1055 tgctaatcctatcacaccctgcaattggaggattcctgacacattgtggttggaattc 1112
>29806.m000964 UDP-glucuronosyltransferase, putative
Length = 1425
Score = 58.0 bits (29), Expect = 2e-07
Identities = 38/41 (92%)
Strand = Plus / Plus
Query: 1085 caattggaggatttgtgacgcattgtggatggaattcaaca 1125
|||||||||| ||| |||| |||||||||||||||||||||
Sbjct: 1097 caattggagggtttctgacacattgtggatggaattcaaca 1137
>29801.m003142 UDP-glucosyltransferase, putative
Length = 1440
Score = 58.0 bits (29), Expect = 2e-07
Identities = 71/85 (83%)
Strand = Plus / Plus
Query: 1083 agcaattggaggatttgtgacgcattgtggatggaattcaacattggaagcaataagctc 1142
||||||||||||||| || || ||||| |||||||||||||| | ||||||||| |
Sbjct: 1074 agcaattggaggattcgtaactcattgcggatggaattcaacgcttgaagcaatagcggc 1133
Query: 1143 aggtgtgccgatggctacatggcca 1167
||| ||||| |||| ||||||||||
Sbjct: 1134 aggagtgccaatggttacatggcca 1158
>29854.m001107 UDP-glucosyltransferase, putative
Length = 1113
Score = 56.0 bits (28), Expect = 6e-07
Identities = 43/48 (89%)
Strand = Plus / Plus
Query: 49 gcccaaggccatatgattccaatggtagatattgccaagctgttggca 96
|||||||||||||||||||| ||| |||| ||||| || |||||||||
Sbjct: 4 gcccaaggccatatgattcccatgatagacattgcaaaactgttggca 51
>29827.m002568 UDP-glucosyltransferase, putative
Length = 1437
Score = 52.0 bits (26), Expect = 1e-05
Identities = 29/30 (96%)
Strand = Plus / Plus
Query: 1108 tgtggatggaattcaacattggaagcaata 1137
|||||||||||||||||| |||||||||||
Sbjct: 1126 tgtggatggaattcaacagtggaagcaata 1155
>29801.m003143 UDP-glucosyltransferase, putative
Length = 1461
Score = 52.0 bits (26), Expect = 1e-05
Identities = 38/42 (90%)
Strand = Plus / Plus
Query: 1084 gcaattggaggatttgtgacgcattgtggatggaattcaaca 1125
|||||||||||||| || || |||||||||||||| ||||||
Sbjct: 1096 gcaattggaggattcgttactcattgtggatggaactcaaca 1137