Jatropha Genome Database

JcCA0307631.10
Show Alignment: 
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0307631.10 + phase: 0 
         (1482 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29579.m000198 UDP-glucosyltransferase, putative                       159   6e-38
29801.m003126 UDP-glucosyltransferase, putative                        66   6e-10
30078.m002217 UDP-glucosyltransferase, putative                        62   1e-08
30078.m002216 UDP-glucosyltransferase, putative                        60   4e-08
29806.m000964 UDP-glucuronosyltransferase, putative                    58   2e-07
29801.m003142 UDP-glucosyltransferase, putative                        58   2e-07
29854.m001107 UDP-glucosyltransferase, putative                        56   6e-07
29827.m002568 UDP-glucosyltransferase, putative                        52   1e-05
29801.m003143 UDP-glucosyltransferase, putative                        52   1e-05

>29579.m000198 UDP-glucosyltransferase, putative
          Length = 1479

 Score =  159 bits (80), Expect = 6e-38
 Identities = 206/248 (83%)
 Strand = Plus / Plus

                                                                        
Query: 979  gaaatagagaaatgggtttcagagactgggttcgaagagagaataaaaggaagaggtctt 1038
            ||||||||||||||| ||  ||||| ||| || ||  ||||||  |||||||||||||||
Sbjct: 976  gaaatagagaaatggattgaagagagtggatttgagcagagaacgaaaggaagaggtctt 1035

                                                                        
Query: 1039 ttcattagcggctgggcgccacaaatgctaatactgtcacacccagcaattggaggattt 1098
             | ||| ||||||||||||||||| | || ||| | ||||| || ||||||||||| |||
Sbjct: 1036 ctgattcgcggctgggcgccacaagtactgatattatcacatcctgcaattggaggtttt 1095

                                                                        
Query: 1099 gtgacgcattgtggatggaattcaacattggaagcaataagctcaggtgtgccgatggct 1158
             |||| ||||| || |||||||||||||||||||||||||   | ||  |||| |||| |
Sbjct: 1096 ctgacacattgcggttggaattcaacattggaagcaataactgccggattgcctatggtt 1155

                                                                        
Query: 1159 acatggccactttttgctgatcaatttattaatgagaagctagttattcaggtactgaag 1218
            |||||||||||||| || || ||||||  |||||||||| | ||| |||| |||||||||
Sbjct: 1156 acatggccacttttcgcggaccaattttgtaatgagaagttggttgttcaagtactgaag 1215

                    
Query: 1219 attggtgt 1226
            ||||||||
Sbjct: 1216 attggtgt 1223


>29801.m003126 UDP-glucosyltransferase, putative
          Length = 1164

 Score = 65.9 bits (33), Expect = 6e-10
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                     
Query: 1087 attggaggatttgtgacgcattgtggatggaattcaacatt 1127
            |||||||||||| |||| |||||||||||||||||||||||
Sbjct: 1075 attggaggatttatgactcattgtggatggaattcaacatt 1115


>30078.m002217 UDP-glucosyltransferase, putative
          Length = 690

 Score = 61.9 bits (31), Expect = 1e-08
 Identities = 64/75 (85%)
 Strand = Plus / Plus

                                                                        
Query: 1051 tgggcgccacaaatgctaatactgtcacacccagcaattggaggatttgtgacgcattgt 1110
            |||||||||||| ||| |||| | || || |||||||||||||||||  |||| ||||| 
Sbjct: 247  tgggcgccacaagtgccaatattatctcatccagcaattggaggattcttgacccattgc 306

                           
Query: 1111 ggatggaattcaaca 1125
            || ||||||||||||
Sbjct: 307  ggttggaattcaaca 321


>30078.m002216 UDP-glucosyltransferase, putative
          Length = 1452

 Score = 60.0 bits (30), Expect = 4e-08
 Identities = 51/58 (87%)
 Strand = Plus / Plus

                                                                      
Query: 1064 tgctaatactgtcacacccagcaattggaggatttgtgacgcattgtggatggaattc 1121
            ||||||| || |||||||| ||||||||||||||  |||| |||||||| ||||||||
Sbjct: 1055 tgctaatcctatcacaccctgcaattggaggattcctgacacattgtggttggaattc 1112


>29806.m000964 UDP-glucuronosyltransferase, putative
          Length = 1425

 Score = 58.0 bits (29), Expect = 2e-07
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                     
Query: 1085 caattggaggatttgtgacgcattgtggatggaattcaaca 1125
            |||||||||| ||| |||| |||||||||||||||||||||
Sbjct: 1097 caattggagggtttctgacacattgtggatggaattcaaca 1137


>29801.m003142 UDP-glucosyltransferase, putative
          Length = 1440

 Score = 58.0 bits (29), Expect = 2e-07
 Identities = 71/85 (83%)
 Strand = Plus / Plus

                                                                        
Query: 1083 agcaattggaggatttgtgacgcattgtggatggaattcaacattggaagcaataagctc 1142
            ||||||||||||||| || || ||||| ||||||||||||||  | |||||||||    |
Sbjct: 1074 agcaattggaggattcgtaactcattgcggatggaattcaacgcttgaagcaatagcggc 1133

                                     
Query: 1143 aggtgtgccgatggctacatggcca 1167
            ||| ||||| |||| ||||||||||
Sbjct: 1134 aggagtgccaatggttacatggcca 1158


>29854.m001107 UDP-glucosyltransferase, putative
          Length = 1113

 Score = 56.0 bits (28), Expect = 6e-07
 Identities = 43/48 (89%)
 Strand = Plus / Plus

                                                          
Query: 49 gcccaaggccatatgattccaatggtagatattgccaagctgttggca 96
          |||||||||||||||||||| ||| |||| ||||| || |||||||||
Sbjct: 4  gcccaaggccatatgattcccatgatagacattgcaaaactgttggca 51


>29827.m002568 UDP-glucosyltransferase, putative
          Length = 1437

 Score = 52.0 bits (26), Expect = 1e-05
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                          
Query: 1108 tgtggatggaattcaacattggaagcaata 1137
            |||||||||||||||||| |||||||||||
Sbjct: 1126 tgtggatggaattcaacagtggaagcaata 1155


>29801.m003143 UDP-glucosyltransferase, putative
          Length = 1461

 Score = 52.0 bits (26), Expect = 1e-05
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                      
Query: 1084 gcaattggaggatttgtgacgcattgtggatggaattcaaca 1125
            |||||||||||||| || || |||||||||||||| ||||||
Sbjct: 1096 gcaattggaggattcgttactcattgtggatggaactcaaca 1137