Jatropha Genome Database

JcCA0307051.20
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0307051.20 - phase: 0 /pseudo/partial
         (195 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29822.m003385 transferase, transferring glycosyl groups, putative      58   2e-08
29848.m004477 transferase, transferring glycosyl groups, putative      56   8e-08

>29822.m003385 transferase, transferring glycosyl groups, putative
          Length = 1989

 Score = 58.0 bits (29), Expect = 2e-08
 Identities = 92/113 (81%)
 Strand = Plus / Minus

                                                                        
Query: 7    tccgcctctgatgatctccctaacttctttgtaactatccactcgtaagaacttccaaat 66
            |||| |||||||||||| |||  ||||||||| |||| ||| || ||||  |||||||  
Sbjct: 1697 tccgactctgatgatcttcctgtcttctttgtcactacccattcataagcgcttccaagc 1638

                                                                 
Query: 67   cgaaacaatcccgatatcattgcattgaatttggtcacagacatggtgttttc 119
             |||| | ||| |||| ||| ||||||||||| || |||||||| ||||||||
Sbjct: 1637 tgaaatagtcctgataccatggcattgaattttgtgacagacatagtgttttc 1585


>29848.m004477 transferase, transferring glycosyl groups, putative
          Length = 2082

 Score = 56.0 bits (28), Expect = 8e-08
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                        
Query: 43   atccactcgtaagaacttccaaatcgaaacaatcccgatatcattgcattgaatttggtc 102
            |||||||| |||||||| || ||  | || ||||| |||| ||| |||||||||||||| 
Sbjct: 1745 atccactcataagaactacccaactggaataatccagataccatagcattgaatttggta 1686

                                
Query: 103  acagacatggtgttttcaaa 122
            || ||||||||||| |||||
Sbjct: 1685 actgacatggtgttctcaaa 1666