Jatropha Genome Database

JcCA0306831.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0306831.10 - phase: 0 /pseudo/partial
         (453 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

28725.m000310 RNA splicing protein mrs2, mitochondrial, putative       58   5e-08

>28725.m000310 RNA splicing protein mrs2, mitochondrial, putative
          Length = 1362

 Score = 58.0 bits (29), Expect = 5e-08
 Identities = 65/77 (84%)
 Strand = Plus / Plus

                                                                       
Query: 1   gtgagggatgtaattgaacatatgttggatgatgatgaagatatggcaaatttatacttg 60
           ||||| |||| |||||||||| | || |||||| |||||||||||||| | ||||| |||
Sbjct: 802 gtgagagatgaaattgaacatttattagatgataatgaagatatggcagacttatatttg 861

                            
Query: 61  acaaggaagttgatcca 77
           || || |||| ||||||
Sbjct: 862 acgagaaagtggatcca 878