Jatropha Genome Database

JcCA0306681.20
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0306681.20 - phase: 2 /pseudo/partial
         (271 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30129.m000356 WD-repeat protein, putative                             270   4e-72
30128.m008811 WD-repeat protein, putative                              60   7e-09

>30129.m000356 WD-repeat protein, putative
          Length = 1344

 Score =  270 bits (136), Expect = 4e-72
 Identities = 196/216 (90%)
 Strand = Plus / Plus

                                                                        
Query: 9    gttttgcccaagtatttcagctcagagtggtcagtggctcagttccgattggttgagggt 68
            ||||| || |||||||||||||||||||||||||| |||||||| || ||||||||||| 
Sbjct: 1129 gttttaccaaagtatttcagctcagagtggtcagtagctcagtttcgtttggttgagggc 1188

                                                                        
Query: 69   tctcattacattgttgcttttggtcaccaaaagaatacagttgtgattcttggcttggat 128
            ||||||||||||||||||||||||||||||||||||||||| || |||||||| ||||||
Sbjct: 1189 tctcattacattgttgcttttggtcaccaaaagaatacagtggtaattcttggattggat 1248

                                                                        
Query: 129  ggaagcttctaccgatgtcagttcgacccagtgaatggtggagagatgactcaactggaa 188
            |||||||||||  |||||||||| ||||| |||||||||||||||||| ||||||| |||
Sbjct: 1249 ggaagcttctatagatgtcagtttgacccggtgaatggtggagagatgtctcaactcgaa 1308

                                                
Query: 189  tatcacaacttcttgaagccagaagctgcattctga 224
            |  ||||||||||||||||| ||||| || ||||||
Sbjct: 1309 ttccacaacttcttgaagcctgaagcagccttctga 1344


>30128.m008811 WD-repeat protein, putative
          Length = 993

 Score = 60.0 bits (30), Expect = 7e-09
 Identities = 48/54 (88%)
 Strand = Plus / Plus

                                                                 
Query: 5   aggtgttttgcccaagtatttcagctcagagtggtcagtggctcagttccgatt 58
           |||||| ||||| |||||||||||||||||| |||| || |||||||| |||||
Sbjct: 750 aggtgtcttgccaaagtatttcagctcagagcggtctgtagctcagtttcgatt 803



 Score = 54.0 bits (27), Expect = 4e-07
 Identities = 87/107 (81%)
 Strand = Plus / Plus

                                                                       
Query: 99  aagaatacagttgtgattcttggcttggatggaagcttctaccgatgtcagttcgaccca 158
           ||||| ||| |||| ||| ||||| || |||||||||||||||| ||| |||| ||||||
Sbjct: 844 aagaacacaattgtaattattggcatgaatggaagcttctaccgctgtgagtttgaccca 903

                                                          
Query: 159 gtgaatggtggagagatgactcaactggaatatcacaacttcttgaa 205
            |   ||| |||||||||| ||| || |||| || ||| ||||||||
Sbjct: 904 ttatttggcggagagatgaatcagctcgaatttctcaatttcttgaa 950