Jatropha Genome Database

JcCA0304521.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0304521.10 - phase: 0 /partial/short
         (132 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29667.m000353 conserved hypothetical protein                          127   2e-29

>29667.m000353 conserved hypothetical protein
          Length = 591

 Score =  127 bits (64), Expect = 2e-29
 Identities = 112/128 (87%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggaagtgcggcttagtgatgagaaagatcttccgcagcaagacaagcagcaaatcaac 60
           ||||||||||| ||||| || ||||||||||||  |||| |||| ||||  || || |||
Sbjct: 457 atggaagtgcgacttagcgacgagaaagatcttttgcaggaagataagctacagattaac 516

                                                                       
Query: 61  cgggatctgaagctgttcctgaagcctgtccgtgaaaaattgcttcagtttgagcaggaa 120
           | ||||||||| ||||| ||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 517 caggatctgaaactgtttctgcagcctgtccgtgaaaaattgcttcagtttgagcaggaa 576

                   
Query: 121 ctgaaaga 128
           || |||||
Sbjct: 577 ctcaaaga 584