Jatropha Genome Database

JcCA0302081.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0302081.10 + phase: 1 /partial
         (164 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30147.m014191 40S ribosomal protein S20, putative                     196   3e-50

>30147.m014191 40S ribosomal protein S20, putative
          Length = 375

 Score =  196 bits (99), Expect = 3e-50
 Identities = 144/159 (90%)
 Strand = Plus / Plus

                                                                       
Query: 6   aaatccccatgtggcgaaggaaccaacacatgggacagatttgagctccgtgtccacaag 65
           ||||| |||||||| |||||||| || |||||||||||||||||||| || |||||||||
Sbjct: 214 aaatctccatgtggtgaaggaacaaatacatgggacagatttgagcttcgagtccacaag 273

                                                                       
Query: 66  cgtgttattgacctgttcagttcacctgaggtggtcaaacaaatcacttccattacaatt 125
           |||||||| |||||||||||||| || || |||||||| || ||||||||||||||||||
Sbjct: 274 cgtgttatcgacctgttcagttccccagatgtggtcaagcagatcacttccattacaatt 333

                                                  
Query: 126 gaacctggtgttgaggtggaagttacaattgcagattca 164
           |||||||| |||||||| |||||||| ||||||||||||
Sbjct: 334 gaacctggcgttgaggtcgaagttactattgcagattca 372