Jatropha Genome Database

JcCA0301931.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0301931.10 + phase: 0 
         (1530 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

60499.m000013 aromatic amino acid decarboxylase, putative              68   2e-10

>60499.m000013 aromatic amino acid decarboxylase, putative
          Length = 719

 Score = 67.9 bits (34), Expect = 2e-10
 Identities = 64/74 (86%)
 Strand = Plus / Plus

                                                                       
Query: 97  atagacttcattgctgattattatcagaacatcgaaaaatacccagttttaagccaggtt 156
           ||||| ||||||||||| |||||  | ||||| |||||||||||||||  ||||||||||
Sbjct: 7   atagatttcattgctgagtattacaaaaacatagaaaaatacccagttcaaagccaggtt 66

                         
Query: 157 gaacctggttatct 170
            ||||||| |||||
Sbjct: 67  caacctggatatct 80