Jatropha Genome Database
- JcCA0299751.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCA0299751.10 - phase: 1 /pseudo/partial
(299 letters)
Database: castor_wgs_0.1_cds
31,221 sequences; 31,347,911 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
30190.m011235 potassium channel tetramerization domain-containin... 76 1e-13
>30190.m011235 potassium channel tetramerization
domain-containingprotein, putative
Length = 1425
Score = 75.8 bits (38), Expect = 1e-13
Identities = 95/114 (83%)
Strand = Plus / Plus
Query: 55 tctctcttagcgattccccgaaatctagctgctgcgggagccaccgatttctcgggtatg 114
||||| ||||| ||| ||| |||| |||| ||||| |||||||||||||| || || |||
Sbjct: 544 tctcttttagcaatttccccaaatttagcagctgctggagccaccgatttttccgggatg 603
Query: 115 caaattctcgatcttgaaaagatttgtgttagggacagtctgtgttgagaaaac 168
|||||||| |||||||||||| || |||||| | | ||||||||| ||||||
Sbjct: 604 caaattcttgatcttgaaaagggttttgttagagcaactctgtgttgggaaaac 657