Jatropha Genome Database

JcCA0298471.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0298471.10 + phase: 0 
         (207 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

28623.m000398 vacuolar ATP synthase proteolipid subunit 1, 2, 3,...   202   6e-52
30170.m014224 vacuolar ATP synthase proteolipid subunit 1, 2, 3,...   115   1e-25
30131.m007140 vacuolar ATP synthase proteolipid subunit 1, 2, 3,...    76   9e-14

>28623.m000398 vacuolar ATP synthase proteolipid subunit 1, 2, 3,
           putative
          Length = 498

 Score =  202 bits (102), Expect = 6e-52
 Identities = 120/126 (95%)
 Strand = Plus / Plus

                                                                       
Query: 75  agctaatgcacagcagccaaagctttttgttggcatgattctcattctcatttttgctga 134
           ||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||
Sbjct: 366 agctaatgcacagcagccaaagctttttgttggaatgattctcattctcatctttgctga 425

                                                                       
Query: 135 ggcactggctctttatggactcattgttggcatcatcctttcttctcgagctgggcaatc 194
           |||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |||||
Sbjct: 426 ggcactggctctctatggactcattgttggcatcatcctttcttctcgtgctggtcaatc 485

                 
Query: 195 tcgagc 200
           | ||||
Sbjct: 486 tagagc 491


>30170.m014224 vacuolar ATP synthase proteolipid subunit 1, 2, 3,
           putative
          Length = 498

 Score =  115 bits (58), Expect = 1e-25
 Identities = 100/114 (87%)
 Strand = Plus / Plus

                                                                       
Query: 75  agctaatgcacagcagccaaagctttttgttggcatgattctcattctcatttttgctga 134
           ||||||||||||||||||||||||||||||||| ||||| ||||||||||| ||||| ||
Sbjct: 366 agctaatgcacagcagccaaagctttttgttgggatgatcctcattctcatctttgccga 425

                                                                 
Query: 135 ggcactggctctttatggactcattgttggcatcatcctttcttctcgagctgg 188
            ||  ||||||| ||||| || |||||||| ||||| ||||| || ||||||||
Sbjct: 426 agccttggctctctatggccttattgttgggatcatactttcgtcccgagctgg 479


>30131.m007140 vacuolar ATP synthase proteolipid subunit 1, 2, 3,
           putative
          Length = 498

 Score = 75.8 bits (38), Expect = 9e-14
 Identities = 95/114 (83%)
 Strand = Plus / Plus

                                                                       
Query: 75  agctaatgcacagcagccaaagctttttgttggcatgattctcattctcatttttgctga 134
           |||||||||||| || ||||| ||||||||||| ||||| || || ||||||||||||||
Sbjct: 366 agctaatgcacaacaaccaaaactttttgttggtatgatcctgatcctcatttttgctga 425

                                                                 
Query: 135 ggcactggctctttatggactcattgttggcatcatcctttcttctcgagctgg 188
            ||  ||||  | ||||| || ||||||||||||||| | ||||| || |||||
Sbjct: 426 agctttggcattgtatgggcttattgttggcatcatcttgtcttcccgggctgg 479