Jatropha Genome Database

JcCA0298021.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0298021.10 + phase: 1 /partial
         (401 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29728.m000804 serine-threonine protein kinase, plant-type, putative    96   2e-19
29728.m000805 serine-threonine protein kinase, plant-type, putative    88   5e-17

>29728.m000804 serine-threonine protein kinase, plant-type, putative
          Length = 2196

 Score = 95.6 bits (48), Expect = 2e-19
 Identities = 72/80 (90%)
 Strand = Plus / Plus

                                                                        
Query: 66   gagatatttacaggaaagagaccaactgatgattttttcaaagttgatctaaaccttcgt 125
            ||||| ||||||||||||| |||||||||||| | |||||||| |||||||||||||| |
Sbjct: 1825 gagatgtttacaggaaagaaaccaactgatgagtctttcaaagatgatctaaaccttcat 1884

                                
Query: 126  acctttgttgagagatcttt 145
            || |||||||||| ||||||
Sbjct: 1885 acttttgttgagacatcttt 1904


>29728.m000805 serine-threonine protein kinase, plant-type, putative
          Length = 2772

 Score = 87.7 bits (44), Expect = 5e-17
 Identities = 71/80 (88%)
 Strand = Plus / Plus

                                                                        
Query: 66   gagatatttacaggaaagagaccaactgatgattttttcaaagttgatctaaaccttcgt 125
            ||||| ||||||||||||| |||||||||||| | ||| |||| |||||||||||||| |
Sbjct: 2500 gagatgtttacaggaaagaaaccaactgatgagtcttttaaagatgatctaaaccttcat 2559

                                
Query: 126  acctttgttgagagatcttt 145
            || ||| |||||||||||||
Sbjct: 2560 acttttattgagagatcttt 2579



 Score = 71.9 bits (36), Expect = 3e-12
 Identities = 69/80 (86%)
 Strand = Plus / Plus

                                                                        
Query: 237  ctaagaattggagttgcatgcacaatggaacagccaggggaaaggatggaaatgcgagat 296
            ||||||||||||||||||||  |||| ||||| ||||| || || ||| | ||| |||||
Sbjct: 2668 ctaagaattggagttgcatgttcaattgaacaaccaggagatagaatgaagatgagagat 2727

                                
Query: 297  gtgataaatgaattgcaaaa 316
            |||||||| |||||||||||
Sbjct: 2728 gtgataaaggaattgcaaaa 2747