Jatropha Genome Database
- JcCA0297911.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCA0297911.10 - phase: 0
(303 letters)
Database: castor_wgs_0.1_cds
31,221 sequences; 31,347,911 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
29693.m002025 60S ribosomal protein L18a, putative 76 1e-13
>29693.m002025 60S ribosomal protein L18a, putative
Length = 912
Score = 75.8 bits (38), Expect = 1e-13
Identities = 71/82 (86%)
Strand = Plus / Plus
Query: 220 acaggttatgcggttattgagggaaggcccgtgagagaacacaggcttccatgttgtggt 279
|||||||||||||||||||| | || ||| ||| ||||| ||||| ||||| ||||||
Sbjct: 196 acaggttatgcggttattgaagctagacccctgattgaacataggctaccatgctgtggt 255
Query: 280 ttgggcatgggatggttcttgt 301
|||||||||||||||||||||
Sbjct: 256 ctgggcatgggatggttcttgt 277
Score = 61.9 bits (31), Expect = 2e-09
Identities = 55/63 (87%)
Strand = Plus / Plus
Query: 40 ggcaacccgcagacccagtattatgggacttttcaaggcgtcgccaattactatccttct 99
||||||||||| | ||||||||||||| ||||| ||||||||||| ||||| ||||||
Sbjct: 34 ggcaacccgcaaggcgagtattatgggacatttcagggcgtcgccaactactacccttct 93
Query: 100 gtt 102
|||
Sbjct: 94 gtt 96