Jatropha Genome Database
- JcCA0296741.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCA0296741.10 + phase: 0
(369 letters)
Database: castor_wgs_0.1_cds
31,221 sequences; 31,347,911 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
30078.m002287 Bud site selection protein, putative 218 2e-56
>30078.m002287 Bud site selection protein, putative
Length = 273
Score = 218 bits (110), Expect = 2e-56
Identities = 221/258 (85%)
Strand = Plus / Plus
Query: 105 ggtgtatgaggagctgcaaaagcctgatgtggagaagaagtccttgcctctagacgagga 164
||||||||| ||||| ||||||||||| ||||| || || |||||||| || |||||
Sbjct: 3 ggtgtatgatgagctaaaaaagcctgattcagagaaaaaatcgttgcctcttgatgagga 62
Query: 165 cttgcctggcatgggccaatattattgcttgcactgcgaccgatactttgctaatgtgac 224
||||||||||||||| ||||||||||| ||||||||||||||||| ||||||||||||||
Sbjct: 63 cttgcctggcatgggtcaatattattgtttgcactgcgaccgatattttgctaatgtgac 122
Query: 225 tgtgagggacgagcatttcaagaccaaacgccacagaaagcgtttgaagcaaatgatggg 284
| | ||||| || ||||| || ||||||| |||| ||||| ||||||||||| |||
Sbjct: 123 tataagggatgatcattttaaatccaaacgacacaagaagcgcgtgaagcaaatgtcggg 182
Query: 285 acctgcaccgcacactcaacttgatgctgacttagctggtgggatgggtatgccagataa 344
|||||| || || || |||||||||||||| ||||||| ||| ||||||||||| |||||
Sbjct: 183 acctgcgccacatacacaacttgatgctgatttagctgctggcatgggtatgccggataa 242
Query: 345 tggtcctaagcttatgtc 362
||| ||||||||||||||
Sbjct: 243 tggccctaagcttatgtc 260