Jatropha Genome Database

JcCA0293541.20
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0293541.20 - phase: 2 /partial
         (226 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30169.m006396 conserved hypothetical protein                           54   4e-07

>30169.m006396 conserved hypothetical protein
          Length = 216

 Score = 54.0 bits (27), Expect = 4e-07
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                              
Query: 159 aggactcggccagggaagtcccaactggaccagaccctcttcaccacaaca 209
           |||| ||||| || ||||| |||||||||||||| |||||||| |||||||
Sbjct: 146 aggattcggcaagagaagtgccaactggaccagatcctcttcatcacaaca 196