Jatropha Genome Database

JcCA0290791.20
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0290791.20 - phase: 0 
         (243 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29736.m002116 conserved hypothetical protein                           80   7e-15

>29736.m002116 conserved hypothetical protein
          Length = 207

 Score = 79.8 bits (40), Expect = 7e-15
 Identities = 58/64 (90%)
 Strand = Plus / Plus

                                                                       
Query: 59  tgttggtcatggttgttgctgctcatgaaggccatgaacacactcctggcatggtcatgt 118
           |||||||||||||||||||||| ||||||||||| || ||||  ||||||||||||||| 
Sbjct: 35  tgttggtcatggttgttgctgcacatgaaggccacgagcacatgcctggcatggtcatgc 94

               
Query: 119 ctcc 122
           ||||
Sbjct: 95  ctcc 98