Jatropha Genome Database

JcCA0285831.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0285831.10 - phase: 0 
         (537 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

28076.m000416 structural constituent of cell wall, putative            62   4e-09

>28076.m000416 structural constituent of cell wall, putative
          Length = 537

 Score = 61.9 bits (31), Expect = 4e-09
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                          
Query: 173 cagattcaccaatatcatcaccgccagcgcctccaccttcagatctg 219
           ||||||||||||| |||||||||||||| ||||| || |||||||||
Sbjct: 203 cagattcaccaatctcatcaccgccagcacctcctccgtcagatctg 249