Jatropha Genome Database

JcCA0282791.10
Show Alignment: 
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0282791.10 - phase: 0 /partial
         (174 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29729.m002361 Alpha-expansin 8 precursor, putative                    143   4e-34
29804.m001486 Alpha-expansin 8 precursor, putative                    103   3e-22
28842.m000919 Alpha-expansin 1 precursor, putative                     76   7e-14
28223.m000099 Alpha-expansin 4 precursor, putative                     76   7e-14
28649.m000224 Alpha-expansin 5 precursor, putative                     72   1e-12
30138.m004059 Alpha-expansin 15 precursor, putative                    70   5e-12
30076.m004517 Alpha-expansin 1 precursor, putative                     62   1e-09
30076.m004515 Alpha-expansin 8 precursor, putative                     62   1e-09
29950.m001164 Alpha-expansin 15 precursor, putative                    60   4e-09
29044.m000170 Alpha-expansin 8 precursor, putative                     56   7e-08
30170.m014276 Alpha-expansin 11 precursor, putative                    54   3e-07
29813.m001510 Alpha-expansin 1 precursor, putative                     52   1e-06

>29729.m002361 Alpha-expansin 8 precursor, putative
          Length = 759

 Score =  143 bits (72), Expect = 4e-34
 Identities = 123/140 (87%)
 Strand = Plus / Plus

                                                                       
Query: 31  cttctactctttgtgctaaatttatgctttagaggcacttatggtgactatggaggctgg 90
           |||||| ||||| |||| ||| | ||| ||||||| |||||||| ||||||||||| |||
Sbjct: 31  cttctattctttctgctgaatctttgccttagaggtacttatggagactatggaggttgg 90

                                                                       
Query: 91  caaagtggccatgccaccttctatggcgggggtgatgcttctggcacaatgggtggtgct 150
           |||||||  |||||||| |||||||| |||||||||||||| ||||||||||| ||||||
Sbjct: 91  caaagtgctcatgccactttctatggtgggggtgatgcttccggcacaatgggaggtgct 150

                               
Query: 151 tgtggatatggcaatttgta 170
           ||||| ||||| ||||||||
Sbjct: 151 tgtgggtatggaaatttgta 170


>29804.m001486 Alpha-expansin 8 precursor, putative
          Length = 771

 Score =  103 bits (52), Expect = 3e-22
 Identities = 82/92 (89%)
 Strand = Plus / Plus

                                                                       
Query: 79  tatggaggctggcaaagtggccatgccaccttctatggcgggggtgatgcttctggcaca 138
           |||||||| |||||| |||| || ||||||||||||||||| |||||||| |||||||||
Sbjct: 91  tatggaggatggcaaggtggtcacgccaccttctatggcggtggtgatgcatctggcaca 150

                                           
Query: 139 atgggtggtgcttgtggatatggcaatttgta 170
           ||||| || || ||||||||||| ||||||||
Sbjct: 151 atgggaggagcatgtggatatgggaatttgta 182


>28842.m000919 Alpha-expansin 1 precursor, putative
          Length = 744

 Score = 75.8 bits (38), Expect = 7e-14
 Identities = 56/62 (90%)
 Strand = Plus / Plus

                                                                       
Query: 100 catgccaccttctatggcgggggtgatgcttctggcacaatgggtggtgcttgtggatat 159
           |||||||| |||||||| ||||||||||| ||||| || |||||||| ||||||||||||
Sbjct: 85  catgccactttctatggagggggtgatgcatctgggacgatgggtggggcttgtggatat 144

             
Query: 160 gg 161
           ||
Sbjct: 145 gg 146


>28223.m000099 Alpha-expansin 4 precursor, putative
          Length = 780

 Score = 75.8 bits (38), Expect = 7e-14
 Identities = 74/86 (86%)
 Strand = Plus / Plus

                                                                       
Query: 88  tggcaaagtggccatgccaccttctatggcgggggtgatgcttctggcacaatgggtggt 147
           |||||||||| |||||| || |||||||| ||   ||||||||||||||| |||||||| 
Sbjct: 97  tggcaaagtgcccatgctactttctatggtggttctgatgcttctggcaccatgggtggg 156

                                     
Query: 148 gcttgtggatatggcaatttgtacag 173
           ||||| |||||||| || ||||||||
Sbjct: 157 gcttgcggatatgggaacttgtacag 182


>28649.m000224 Alpha-expansin 5 precursor, putative
          Length = 726

 Score = 71.9 bits (36), Expect = 1e-12
 Identities = 51/56 (91%)
 Strand = Plus / Plus

                                                                   
Query: 100 catgccaccttctatggcgggggtgatgcttctggcacaatgggtggtgcttgtgg 155
           ||||| || |||||||| || |||||||||||||||||||||||||| ||||||||
Sbjct: 85  catgcaactttctatggtggcggtgatgcttctggcacaatgggtggagcttgtgg 140


>30138.m004059 Alpha-expansin 15 precursor, putative
          Length = 750

 Score = 69.9 bits (35), Expect = 5e-12
 Identities = 65/75 (86%)
 Strand = Plus / Plus

                                                                       
Query: 100 catgccaccttctatggcgggggtgatgcttctggcacaatgggtggtgcttgtggatat 159
           ||||| ||||| ||||| || |||||||| ||||| ||||||||||| ||||||||||||
Sbjct: 85  catgctaccttttatggaggtggtgatgcctctggtacaatgggtggggcttgtggatat 144

                          
Query: 160 ggcaatttgtacagc 174
           || || || ||||||
Sbjct: 145 ggaaacttatacagc 159


>30076.m004517 Alpha-expansin 1 precursor, putative
          Length = 768

 Score = 61.9 bits (31), Expect = 1e-09
 Identities = 55/63 (87%)
 Strand = Plus / Plus

                                                                       
Query: 99  ccatgccaccttctatggcgggggtgatgcttctggcacaatgggtggtgcttgtggata 158
           |||||| || |||||||| || ||||| || ||||| |||||||||||||| ||||||||
Sbjct: 93  ccatgcaactttctatggtggaggtgacgcctctggtacaatgggtggtgcctgtggata 152

              
Query: 159 tgg 161
           |||
Sbjct: 153 tgg 155


>30076.m004515 Alpha-expansin 8 precursor, putative
          Length = 768

 Score = 61.9 bits (31), Expect = 1e-09
 Identities = 55/63 (87%)
 Strand = Plus / Plus

                                                                       
Query: 99  ccatgccaccttctatggcgggggtgatgcttctggcacaatgggtggtgcttgtggata 158
           |||||| || ||||| || || ||||| |||||||| |||||||||||||| ||||||||
Sbjct: 93  ccatgcaactttctacggtggaggtgacgcttctggtacaatgggtggtgcctgtggata 152

              
Query: 159 tgg 161
           |||
Sbjct: 153 tgg 155


>29950.m001164 Alpha-expansin 15 precursor, putative
          Length = 744

 Score = 60.0 bits (30), Expect = 4e-09
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 100 catgccaccttctatggcgggggtgatgcttctggcacaatgggtggtgcttgtggatat 159
           ||||| |||||||| || || |||||||||||||| |||||||| || |||||||| |||
Sbjct: 85  catgctaccttctacggaggaggtgatgcttctggtacaatggggggagcttgtggctat 144

             
Query: 160 gg 161
           ||
Sbjct: 145 gg 146


>29044.m000170 Alpha-expansin 8 precursor, putative
          Length = 747

 Score = 56.0 bits (28), Expect = 7e-08
 Identities = 64/76 (84%)
 Strand = Plus / Plus

                                                                       
Query: 99  ccatgccaccttctatggcgggggtgatgcttctggcacaatgggtggtgcttgtggata 158
           |||||| || ||||| |||||  ||||||||||||| |||||||| || |||||||| ||
Sbjct: 87  ccatgctacgttctacggcggcagtgatgcttctggaacaatggggggagcttgtggtta 146

                           
Query: 159 tggcaatttgtacagc 174
           ||| || || ||||||
Sbjct: 147 tggaaacttatacagc 162


>30170.m014276 Alpha-expansin 11 precursor, putative
          Length = 771

 Score = 54.0 bits (27), Expect = 3e-07
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 124 gatgcttctggcacaatgggtggtgcttgtggatatggcaatttgta 170
           |||||||| || || |||||||| |||||||||||||| ||||||||
Sbjct: 124 gatgcttcaggaactatgggtggagcttgtggatatggtaatttgta 170


>29813.m001510 Alpha-expansin 1 precursor, putative
          Length = 750

 Score = 52.0 bits (26), Expect = 1e-06
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 124 gatgcttctggcacaatgggtggtgcttgtggatatgg 161
           ||||||||||||||||||||||| || ||||| |||||
Sbjct: 112 gatgcttctggcacaatgggtggagcatgtggttatgg 149