Jatropha Genome Database
- JcCA0282791.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCA0282791.10 - phase: 0 /partial
(174 letters)
Database: castor_wgs_0.1_cds
31,221 sequences; 31,347,911 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
29729.m002361 Alpha-expansin 8 precursor, putative 143 4e-34
29804.m001486 Alpha-expansin 8 precursor, putative 103 3e-22
28842.m000919 Alpha-expansin 1 precursor, putative 76 7e-14
28223.m000099 Alpha-expansin 4 precursor, putative 76 7e-14
28649.m000224 Alpha-expansin 5 precursor, putative 72 1e-12
30138.m004059 Alpha-expansin 15 precursor, putative 70 5e-12
30076.m004517 Alpha-expansin 1 precursor, putative 62 1e-09
30076.m004515 Alpha-expansin 8 precursor, putative 62 1e-09
29950.m001164 Alpha-expansin 15 precursor, putative 60 4e-09
29044.m000170 Alpha-expansin 8 precursor, putative 56 7e-08
30170.m014276 Alpha-expansin 11 precursor, putative 54 3e-07
29813.m001510 Alpha-expansin 1 precursor, putative 52 1e-06
>29729.m002361 Alpha-expansin 8 precursor, putative
Length = 759
Score = 143 bits (72), Expect = 4e-34
Identities = 123/140 (87%)
Strand = Plus / Plus
Query: 31 cttctactctttgtgctaaatttatgctttagaggcacttatggtgactatggaggctgg 90
|||||| ||||| |||| ||| | ||| ||||||| |||||||| ||||||||||| |||
Sbjct: 31 cttctattctttctgctgaatctttgccttagaggtacttatggagactatggaggttgg 90
Query: 91 caaagtggccatgccaccttctatggcgggggtgatgcttctggcacaatgggtggtgct 150
||||||| |||||||| |||||||| |||||||||||||| ||||||||||| ||||||
Sbjct: 91 caaagtgctcatgccactttctatggtgggggtgatgcttccggcacaatgggaggtgct 150
Query: 151 tgtggatatggcaatttgta 170
||||| ||||| ||||||||
Sbjct: 151 tgtgggtatggaaatttgta 170
>29804.m001486 Alpha-expansin 8 precursor, putative
Length = 771
Score = 103 bits (52), Expect = 3e-22
Identities = 82/92 (89%)
Strand = Plus / Plus
Query: 79 tatggaggctggcaaagtggccatgccaccttctatggcgggggtgatgcttctggcaca 138
|||||||| |||||| |||| || ||||||||||||||||| |||||||| |||||||||
Sbjct: 91 tatggaggatggcaaggtggtcacgccaccttctatggcggtggtgatgcatctggcaca 150
Query: 139 atgggtggtgcttgtggatatggcaatttgta 170
||||| || || ||||||||||| ||||||||
Sbjct: 151 atgggaggagcatgtggatatgggaatttgta 182
>28842.m000919 Alpha-expansin 1 precursor, putative
Length = 744
Score = 75.8 bits (38), Expect = 7e-14
Identities = 56/62 (90%)
Strand = Plus / Plus
Query: 100 catgccaccttctatggcgggggtgatgcttctggcacaatgggtggtgcttgtggatat 159
|||||||| |||||||| ||||||||||| ||||| || |||||||| ||||||||||||
Sbjct: 85 catgccactttctatggagggggtgatgcatctgggacgatgggtggggcttgtggatat 144
Query: 160 gg 161
||
Sbjct: 145 gg 146
>28223.m000099 Alpha-expansin 4 precursor, putative
Length = 780
Score = 75.8 bits (38), Expect = 7e-14
Identities = 74/86 (86%)
Strand = Plus / Plus
Query: 88 tggcaaagtggccatgccaccttctatggcgggggtgatgcttctggcacaatgggtggt 147
|||||||||| |||||| || |||||||| || ||||||||||||||| ||||||||
Sbjct: 97 tggcaaagtgcccatgctactttctatggtggttctgatgcttctggcaccatgggtggg 156
Query: 148 gcttgtggatatggcaatttgtacag 173
||||| |||||||| || ||||||||
Sbjct: 157 gcttgcggatatgggaacttgtacag 182
>28649.m000224 Alpha-expansin 5 precursor, putative
Length = 726
Score = 71.9 bits (36), Expect = 1e-12
Identities = 51/56 (91%)
Strand = Plus / Plus
Query: 100 catgccaccttctatggcgggggtgatgcttctggcacaatgggtggtgcttgtgg 155
||||| || |||||||| || |||||||||||||||||||||||||| ||||||||
Sbjct: 85 catgcaactttctatggtggcggtgatgcttctggcacaatgggtggagcttgtgg 140
>30138.m004059 Alpha-expansin 15 precursor, putative
Length = 750
Score = 69.9 bits (35), Expect = 5e-12
Identities = 65/75 (86%)
Strand = Plus / Plus
Query: 100 catgccaccttctatggcgggggtgatgcttctggcacaatgggtggtgcttgtggatat 159
||||| ||||| ||||| || |||||||| ||||| ||||||||||| ||||||||||||
Sbjct: 85 catgctaccttttatggaggtggtgatgcctctggtacaatgggtggggcttgtggatat 144
Query: 160 ggcaatttgtacagc 174
|| || || ||||||
Sbjct: 145 ggaaacttatacagc 159
>30076.m004517 Alpha-expansin 1 precursor, putative
Length = 768
Score = 61.9 bits (31), Expect = 1e-09
Identities = 55/63 (87%)
Strand = Plus / Plus
Query: 99 ccatgccaccttctatggcgggggtgatgcttctggcacaatgggtggtgcttgtggata 158
|||||| || |||||||| || ||||| || ||||| |||||||||||||| ||||||||
Sbjct: 93 ccatgcaactttctatggtggaggtgacgcctctggtacaatgggtggtgcctgtggata 152
Query: 159 tgg 161
|||
Sbjct: 153 tgg 155
>30076.m004515 Alpha-expansin 8 precursor, putative
Length = 768
Score = 61.9 bits (31), Expect = 1e-09
Identities = 55/63 (87%)
Strand = Plus / Plus
Query: 99 ccatgccaccttctatggcgggggtgatgcttctggcacaatgggtggtgcttgtggata 158
|||||| || ||||| || || ||||| |||||||| |||||||||||||| ||||||||
Sbjct: 93 ccatgcaactttctacggtggaggtgacgcttctggtacaatgggtggtgcctgtggata 152
Query: 159 tgg 161
|||
Sbjct: 153 tgg 155
>29950.m001164 Alpha-expansin 15 precursor, putative
Length = 744
Score = 60.0 bits (30), Expect = 4e-09
Identities = 54/62 (87%)
Strand = Plus / Plus
Query: 100 catgccaccttctatggcgggggtgatgcttctggcacaatgggtggtgcttgtggatat 159
||||| |||||||| || || |||||||||||||| |||||||| || |||||||| |||
Sbjct: 85 catgctaccttctacggaggaggtgatgcttctggtacaatggggggagcttgtggctat 144
Query: 160 gg 161
||
Sbjct: 145 gg 146
>29044.m000170 Alpha-expansin 8 precursor, putative
Length = 747
Score = 56.0 bits (28), Expect = 7e-08
Identities = 64/76 (84%)
Strand = Plus / Plus
Query: 99 ccatgccaccttctatggcgggggtgatgcttctggcacaatgggtggtgcttgtggata 158
|||||| || ||||| ||||| ||||||||||||| |||||||| || |||||||| ||
Sbjct: 87 ccatgctacgttctacggcggcagtgatgcttctggaacaatggggggagcttgtggtta 146
Query: 159 tggcaatttgtacagc 174
||| || || ||||||
Sbjct: 147 tggaaacttatacagc 162
>30170.m014276 Alpha-expansin 11 precursor, putative
Length = 771
Score = 54.0 bits (27), Expect = 3e-07
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 124 gatgcttctggcacaatgggtggtgcttgtggatatggcaatttgta 170
|||||||| || || |||||||| |||||||||||||| ||||||||
Sbjct: 124 gatgcttcaggaactatgggtggagcttgtggatatggtaatttgta 170
>29813.m001510 Alpha-expansin 1 precursor, putative
Length = 750
Score = 52.0 bits (26), Expect = 1e-06
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 124 gatgcttctggcacaatgggtggtgcttgtggatatgg 161
||||||||||||||||||||||| || ||||| |||||
Sbjct: 112 gatgcttctggcacaatgggtggagcatgtggttatgg 149