Jatropha Genome Database
- JcCA0279061.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCA0279061.10 + phase: 0
(678 letters)
Database: castor_wgs_0.1_cds
31,221 sequences; 31,347,911 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
30147.m014313 Dehydration-responsive element-binding protein 1A,... 194 5e-49
60638.m00016 CBF-like transcription factor, putative 52 4e-06
>30147.m014313 Dehydration-responsive element-binding protein 1A,
putative
Length = 711
Score = 194 bits (98), Expect = 5e-49
Identities = 251/302 (83%)
Strand = Plus / Plus
Query: 91 aatttttccgatgaagaattgatgttagcttccagctatccaaagaaacgggctggcaga 150
||||| || ||||||||| | |||||||||||||| ||||| ||||| || || ||||||
Sbjct: 109 aatttctctgatgaagaagtcatgttagcttccagttatcccaagaagcgtgcaggcaga 168
Query: 151 aagaaattccgggagactcgccatcccgtttaccgaggagttcgtaggagaaactccggg 210
||||| || | ||||| | ||||||||||| || |||||||| ||||| || || |||
Sbjct: 169 aagaagtttagagagaccagacatcccgtttatcgtggagttcgcaggaggaattcaggg 228
Query: 211 aagtgggtttgtgaagttagagaacctaataagaaatcaagaatatggttaggaactttt 270
|| ||||| |||||||||||||| || ||||||||||||||||| ||||| || |||||
Sbjct: 229 aaatgggtctgtgaagttagagagcccaataagaaatcaagaatttggttgggcactttc 288
Query: 271 cccacggcggaaatggcagcacgggctcacgacgtggcggcgctggcacttagaggtagg 330
|||| || |||||||| || || || || || |||||||| || || |||||||| |||
Sbjct: 289 gccaccgctgaaatggccgcccgtgcccatgatgtggcggcactagctcttagaggaagg 348
Query: 331 tctgcgtgtttgaattttgcagactcgtcatggcggttgccagtaccagcttcgagtgat 390
||||| |||||||||||||| ||||| || |||||| | |||||||||||||| | ||||
Sbjct: 349 tctgcttgtttgaattttgctgactcatcttggcggctcccagtaccagcttctattgat 408
Query: 391 cc 392
||
Sbjct: 409 cc 410
Score = 65.9 bits (33), Expect = 3e-10
Identities = 84/101 (83%)
Strand = Plus / Plus
Query: 521 tgttttatatggatgaggaggcagttttcggaatgccaggactgcttgcaaatatggcag 580
|||||||||||||||||||| | ||||| |||||||| ||| |||| || ||||||||
Sbjct: 551 tgttttatatggatgaggagactgtttttggaatgcctggattgctaacagatatggcaa 610
Query: 581 agggaatgttgttgcctccacctcagtgcgttgcagagaat 621
||| ||| | ||| |||| ||||| ||| |||||||||||
Sbjct: 611 aggccatgctattgtctccgcctcattgccttgcagagaat 651
>60638.m00016 CBF-like transcription factor, putative
Length = 768
Score = 52.0 bits (26), Expect = 4e-06
Identities = 44/50 (88%)
Strand = Plus / Plus
Query: 214 tgggtttgtgaagttagagaacctaataagaaatcaagaatatggttagg 263
||||| ||||||||||||||||| || |||||||||||||||| ||||
Sbjct: 175 tgggtatgtgaagttagagaaccgaacctgaaatcaagaatatggctagg 224