Jatropha Genome Database

JcCA0274731.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0274731.10 - phase: 1 /partial
         (431 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

30008.m000800 hypothetical protein                                     84   8e-16

>30008.m000800 hypothetical protein
          Length = 1419

 Score = 83.8 bits (42), Expect = 8e-16
 Identities = 63/70 (90%)
 Strand = Plus / Plus

                                                                        
Query: 114  agcgaaataataggttcttggagcctagaaagcagcatggaaggtctccactctaaattg 173
            ||||||||||| |||||||||||| | ||||| ||||||||||| ||||| |||||||| 
Sbjct: 1111 agcgaaataatgggttcttggagcttggaaagtagcatggaaggcctccaatctaaatta 1170

                      
Query: 174  gaaaggtggc 183
            ||||||||||
Sbjct: 1171 gaaaggtggc 1180