Jatropha Genome Database

JcCA0271431.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0271431.10 + phase: 0 
         (651 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29729.m002381 conserved hypothetical protein                           56   3e-07

>29729.m002381 conserved hypothetical protein
          Length = 702

 Score = 56.0 bits (28), Expect = 3e-07
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                       
Query: 478 gttgtgcaagggaaaggagtggattgtggacctgtttgttacttgttgaagacaagtaga 537
           |||||||||||||||| ||  || ||||| |||||||| |||||||| ||||| || |||
Sbjct: 523 gttgtgcaagggaaagaagcagaatgtgggcctgtttgctacttgttaaagactagcaga 582

               
Query: 538 gttg 541
           ||||
Sbjct: 583 gttg 586